Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17327608

Morpholino Name: bmpr1b MO1
Synonyms: ALK6 MO1
Target mRNA: bmpr1b

Morpholino Type: uncategorized morpholino
Sequence: 5' ACTCCACTCTCTGTTCCTCCTTTGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 25/25
genome
MO
5' ACAAAGGAGGGACAGAGAGTGGATT 3'
   |||||||||| |||||||||||| |
3' TGTTTCCTCCTTGTCTCTCACCTCA 5'
5' ACAAAGGAGGAACAGAGAGTGGAGT 3'
   |||||||||||||||||||||||||
3' TGTTTCCTCCTTGTCTCTCACCTCA 5'
5' ACAAAGGAGGAACAGAGAGTGGAGT 3'
   |||||||||||||||||||||||||
3' TGTTTCCTCCTTGTCTCTCACCTCA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:80881867..80881891 25/25 Antisense target bmpr1b.L
Chr1S:65003792..65003816 25/25 Antisense target bmpr1b.S
Chr9_10S:43128172..43128196 22/25 Sense off-target shisa6.S
Chr7S:32992947..32992971 21/25 Sense off-target gbf1.S
Chr2S:108567438..108567462 21/25 Antisense off-target abhd13.S
Chr3L:158550571..158550595 21/25 Sense off-target camta2.L
Chr2S:29257728..29257752 21/25 Antisense off-target mab21l3.S
Chr4S:67118881..67118905 21/25 Antisense off-target LOC108714984
Chr5L:32672394..32672418 21/25 Antisense off-target LOC121393626
Chr1L:214800568..214800592 21/25 unknown
Chr2L:52756932..52756956 21/25 unknown
Chr2S:64944139..64944163 21/25 unknown
Chr8S:14236399..14236423 21/25 unknown
Chr9_10S:16996816..16996840 21/25 unknown
Chr9_10S:16997676..16997700 21/25 unknown
Chr9_10S:45764504..45764528 21/25 unknown
Chr3S:51713601..51713625 21/25 unknown
tropicalis 10.0 Chr1:76143647..76143671 23/25 Antisense target bmpr1b
Chr9:71811662..71811686 22/25 Sense off-target kcnh7
Chr2:29786472..29786496 21/25 Sense off-target ace2
Chr2:29786472..29786496 21/25 Antisense off-target LOC116408790
Publications
First: Differential requirement of bone morphogenetic protein receptors Ia (ALK3) and Ib (ALK6) in early embryonic patterning and neural crest development., BMC Dev Biol 2016                            
Most recent:
View All Papers