Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17327609

Morpholino Name: bmpr1b MO2
Synonyms: ALK6 MO2
Target mRNA: bmpr1b

Morpholino Type: uncategorized morpholino
Sequence: 5' TTGGGAACTTGTCAAACAACCGGCC 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7S:38646145..38646169 24/25 Antisense off-target bmpr1a.S
Chr4L:61312693..61312717 21/25 Sense off-target uba2.L
Chr3S:35494633..35494657 21/25 Antisense off-target adra1a.S
Publications
First: Differential requirement of bone morphogenetic protein receptors Ia (ALK3) and Ib (ALK6) in early embryonic patterning and neural crest development., BMC Dev Biol 2016                            
Most recent:
View All Papers