Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17327615

Morpholino Name: efhc1 MO1
Synonyms:
Target mRNA: efhc1

Morpholino Type: translation blocking morpholino
Sequence: 5' TGAGAAGCCATGTCTGATGTCCAGT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' ACTGGACATCAGACATGGCTTCTCA 3'
   |||||||||||||||||||||||||
3' TGACCTGTAGTCTGTACCGAAGAGT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:162018865..162018889 25/25 Antisense target efhc1.L
Chr5S:135860917..135860941 23/25 unknown
tropicalis 10.0 Chr3:143587850..143587874 21/25 Sense off-target LOC100145100
Chr2:89032433..89032457 21/25 unknown
Publications
First: Identifying domains of EFHC1 involved in ciliary localization, ciliogenesis, and the regulation of Wnt signaling., Dev Biol 2016                        
Most recent:
View All Papers