Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17328314

Morpholino Name: sf3b4 MO2
Synonyms:
Target mRNA: sf3b4

Morpholino Type: splice blocking morpholino
Sequence: 5' GCCAATAACCTGTGAGGAAAAAGAGC 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 23/26
genome
MO
5' GCTCTTTTTCCTCACAGGTTATGGCT 3'
   |||||||||||||||||||||| |  
3' CGAGAAAAAGGAGTGTCCAATAACCG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8S:96507199..96507224 23/26 Antisense target sf3b4.S
Chr3L:18815906..18815931 22/26 unknown
tropicalis 10.0 Chr2:90674997..90675022 22/26 Antisense off-target vav1
Publications
First: Sf3b4-depleted Xenopus embryos: A model to study the pathogenesis of craniofacial defects in Nager syndrome., Dev Biol 2016                        
Most recent:
View All Papers