Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17328440

Morpholino Name: plk4 MO1
Synonyms: Plk4.upMO
Target mRNA: plk4

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' TCTTTTTCTCTCGCTGCTCGCGCCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 23/25 25/25
genome
MO
5' GGGAGCGAGCAGCGAGAGAAAAACA 3'
   ||| ||||||||||||||||||| |
3' CCCGCGCTCGTCGCTCTCTTTTTCT 5'
5' GGGCGCGAGCAGCGAGAGAAAAAGA 3'
   |||||||||||||||||||||||||
3' CCCGCGCTCGTCGCTCTCTTTTTCT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:68294171..68294195 25/25 Antisense target plk4.L
Chr4S:40714491..40714515 21/25 Sense off-target ankrd11.S
Chr7L:91246161..91246185 21/25 unknown
tropicalis 10.0 Chr1:64305706..64305730 23/25 Antisense target plk4
Publications
First: Developmental role of plk4 in Xenopus laevis and Danio rerio: implications for Seckel Syndrome., Biochem Cell Biol 2015    
Most recent:
View All Papers