Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17328441

Morpholino Name: plk4 MO2
Synonyms: Plk4.1MO
Target mRNA: plk4

Morpholino Type: uncategorized morpholino (ATG)
Sequence: 5' CTCTCTCCTATGCTGCCCGCCATGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 24/25
genome
MO
5' GCATGGCTGGCAGCATAGGGGAGAG 3'
   ||||||| ||||||||||| |||||
3' CGTACCGCCCGTCGTATCCTCTCTC 5'
5' GCATGGCGGGCAGCATAGGAGAGAG 3'
   |||||||||||||||||||||||||
3' CGTACCGCCCGTCGTATCCTCTCTC 5'
5' GCATGGCGGGCAGCATAGGGGAGAG 3'
   ||||||||||||||||||| |||||
3' CGTACCGCCCGTCGTATCCTCTCTC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:68294146..68294170 25/25 Antisense target plk4.L
Chr1S:52892394..52892418 24/25 Antisense target plk4.S
Chr1S:52892394..52892418 24/25 Sense off-target LOC108706690
Chr5S:57715253..57715277 21/25 Sense off-target LOC121394230
Chr1S:135982068..135982092 21/25 unknown
tropicalis 10.0 Chr1:64305681..64305705 23/25 Antisense target plk4
Publications
First: Developmental role of plk4 in Xenopus laevis and Danio rerio: implications for Seckel Syndrome., Biochem Cell Biol 2015    
Most recent:
View All Papers