Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17328554

Morpholino Name: vangl2 MO4
Synonyms:
Target mRNA: vangl2

Morpholino Type: uncategorized morpholino
Sequence: 5' GAGTACCGGCTTTTGTGGCGATCCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25 25/25
genome
MO
5' TGGAACGGCACAAAAGCCGCTACTC 3'
   |||| || ||||||||||| |||||
3' ACCTAGCGGTGTTTTCGGCCATGAG 5'
5' TGGATCGCCACAAAAGCCGGTACTC 3'
   |||||||||||||||||||||||||
3' ACCTAGCGGTGTTTTCGGCCATGAG 5'
5' TGGATCGCCACAAAAGCCGGTACTC 3'
   |||||||||||||||||||||||||
3' ACCTAGCGGTGTTTTCGGCCATGAG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:127346529..127346553 25/25 Antisense target vangl2.L
Chr8S:99085622..99085646 25/25 Antisense target vangl2.S
tropicalis 10.0 Chr8:137136592..137136616 22/25 Antisense target vangl2
Publications
First: The involvement of PCP proteins in radial cell intercalations during Xenopus embryonic development., Dev Biol 2015                                
Most recent: Par3 interacts with Prickle3 to generate apical PCP complexes in the vertebrate neural plate., Elife 2018                                                            
View All Papers