Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17328744

Morpholino Name: sall4 MO1
Synonyms:
Target mRNA: sall4

Morpholino Type: uncategorized morpholino
Sequence: 5' GCCAATTATTCCCTTTCTCCACCAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' GTGGTGGAGAAAGGGAATAATTGGC 3'
   |||||||||||||||||||||||||
3' CACCACCTCTTTCCCTTATTAACCG 5'
5' GTGGTGGAGAAAGGGAATAATTGGC 3'
   |||||||||||||||||||||||||
3' CACCACCTCTTTCCCTTATTAACCG 5'
5' GTGGTGGAGAAAGGGAATAATTGGC 3'
   |||||||||||||||||||||||||
3' CACCACCTCTTTCCCTTATTAACCG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:11616470..11616494 25/25 Antisense target sall4.L
Chr9_10S:10463716..10463740 25/25 Antisense target sall4.S
Chr1S:31584051..31584075 22/25 Antisense off-target vps37a.S
tropicalis 10.0 Chr10:35230236..35230260 25/25 Antisense target sall4
Chr6:27911204..27911228 22/25 Sense off-target malrd1
Publications
First: Spalt-like 4 promotes posterior neural fates via repression of pou5f3 family members in Xenopus., Development 2014                                                                  
Most recent:
View All Papers