Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17329155

Morpholino Name: sfrp2 MO1
Synonyms:
Target mRNA: sfrp2

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' AGCGCGACCCGCTGTGCCACATGAT 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' ATCATGTGGCACAGCGGGTCGCGCT 3'
   |||||||||||||||||||||||||
3' TAGTACACCGTGTCGCCCAGCGCGA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1S:43980724..43980748 25/25 Antisense target sfrp2.S
Chr7L:139183816..139183840 21/25 Sense off-target LOC108705069
Chr3L:64211751..64211775 21/25 unknown
Publications
First: Secreted Frizzled-related Protein 2 (sFRP2) Redirects Non-canonical Wnt Signaling from Fz7 to Ror2 during Vertebrate Gastrulation., J Biol Chem 2016                
Most recent:
View All Papers