Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17329511

Morpholino Name: nadk MO1
Synonyms:
Target mRNA: nadk

Morpholino Type: uncategorized morpholino
Sequence: 5' ACACTTTGCCCTGGGATCTCTCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 25/25
genome
MO
5' ATGGAGAGATCCCAGGGCAAAGTGT 3'
   |||||||||||||||||||||||||
3' TACCTCTCTAGGGTCCCGTTTCACA 5'
5' ATGGAGAGACCCCAGGGCAAAGAGT 3'
   ||||||||| |||||||||||| ||
3' TACCTCTCTAGGGTCCCGTTTCACA 5'
5' ATGGAGAGATCCCAGGGCAAAGTGT 3'
   |||||||||||||||||||||||||
3' TACCTCTCTAGGGTCCCGTTTCACA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7S:80266616..80266640 25/25 Antisense target nadk.S
Chr7L:95556459..95556483 23/25 Antisense target nadk.L
Chr9_10S:113693000..113693024 22/25 Antisense off-target tnfrsf12a.S
tropicalis 10.0 Chr7:91999340..91999364 25/25 Antisense target nadk
Chr2:36358177..36358201 21/25 Antisense off-target anos1
Publications
First: NAD kinase controls animal NADP biosynthesis and is modulated via evolutionarily divergent calmodulin-dependent mechanisms., Proc Natl Acad Sci U S A 2015                      
Most recent:
View All Papers