Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17329521

Morpholino Name: nadk MO2
Synonyms:
Target mRNA: nadk

Morpholino Type: splice blocking morpholino (E1-I1)
Sequence: 5' CATTCCAAGTCATTCCACACCTGAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 25/25
genome
MO
5' TTCAGGTGTGGAATGACTTGGAATG 3'
   |||||||||||||||||||||||||
3' AAGTCCACACCTTACTGAACCTTAC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:30673185..30673209 21/25 Antisense off-target sptbn2.L
Chr4S:1124771..1124795 21/25 Antisense off-target LOC108715130
Chr2L:10370991..10371015 21/25 unknown
Chr8L:109658073..109658097 21/25 unknown
tropicalis 10.0 Chr7:91999514..91999538 25/25 Antisense target nadk
Chr2:120022388..120022412 21/25 Sense off-target fgf14
Chr4:39113197..39113221 21/25 Antisense off-target sptbn2
Publications
First: NAD kinase controls animal NADP biosynthesis and is modulated via evolutionarily divergent calmodulin-dependent mechanisms., Proc Natl Acad Sci U S A 2015                      
Most recent:
View All Papers