Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17329617

Morpholino Name: elp3 MO1
Synonyms:
Target mRNA: elp3

Morpholino Type: uncategorized morpholino
Sequence: 5' TTCATGTTGCCCGATGTTCCGCTAG 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' CTAGCGGAACATCGGGCAACATGAA 3'
   |||||||||||||||||||||||||
3' GATCGCCTTGTAGCCCGTTGTACTT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:163926906..163926930 25/25 Antisense target elp3.L
Publications
First: Elongator Protein 3 (Elp3) stabilizes Snail1 and regulates neural crest migration in Xenopus., Sci Rep 2016              
Most recent:
View All Papers