Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17329621

Morpholino Name: adprhl1 MO1
Synonyms: Adprhl1-e2i2MO
Target mRNA: adprhl1

Morpholino Type: splice blocking morpholino (E2-I2)
Sequence: 5' AGGCTCAGCATCTTACAAACCTTTT 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 23/25
genome
MO
5' AAAAGGTTTGTAAGGTGCTGAGCCC 3'
   |||||||||||||| ||||||||| 
3' TTTTCCAAACATTCTACGACTCGGA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2S:106627471..106627495 23/25 Antisense target adprhl1.S
Chr1L:179851433..179851457 22/25 Sense off-target LOC108717058
Chr1L:211765493..211765517 21/25 unknown
Chr6L:129184710..129184734 21/25 unknown
tropicalis 10.0 Chr7:104903809..104903833 21/25 Antisense off-target cnot3
Chr1:192812311..192812335 21/25 unknown
Publications
First: The cardiac-restricted protein ADP-ribosylhydrolase-like 1 is essential for heart chamber outgrowth and acts on muscle actin filament assembly., Dev Biol 2016                                                        
Most recent: Defective heart chamber growth and myofibrillogenesis after knockout of adprhl1 gene function by targeted disruption of the ancestral catalytic active site., PLoS One 2020                                              
View All Papers