Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18006212

Morpholino Name: egln2 MO1
Synonyms: phd1 MO
Target mRNA: egln2

Morpholino Type: uncategorized morpholino
Sequence: 5' TCCCTGCTGATGCCCTCTATCCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genome
MO
5' GATGGATAGAGGGCATCAGCCGGGA 3'
   |||||||||||||||||||| ||||
3' CTACCTATCTCCCGTAGTCGTCCCT 5'
5' GATGGATAGAGGGCATCAGCAGGGA 3'
   |||||||||||||||||||||||||
3' CTACCTATCTCCCGTAGTCGTCCCT 5'
5' GATGGATAGAGGGCATCAGCAGGGG 3'
   |||||||||||||||||||||||| 
3' CTACCTATCTCCCGTAGTCGTCCCT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:70153263..70153287 25/25 Antisense target egln2.L
Chr8S:84753736..84753760 24/25 Antisense target egln2.S
Chr1L:55270612..55270636 22/25 Sense off-target fstl5.L
Chr4S:128801018..128801042 21/25 unknown
tropicalis 10.0 Chr8:78647071..78647095 24/25 Antisense target egln2
Chr5:3618117..3618141 21/25 Sense off-target mdga1
Publications
First: Suppression of vascular network formation by chronic hypoxia and prolyl-hydroxylase 2 (phd2) deficiency during vertebrate development., Angiogenesis 2016    
Most recent:
View All Papers