Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18006213

Morpholino Name: egln1 MO1
Synonyms: phd2 MO
Target mRNA: egln1

Morpholino Type: uncategorized morpholino
Sequence: 5' ATGTCTGTCTGCTGTCTCCCAATTA 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' TAATTGGGAGACAGCAGACAGACAT 3'
   |||||||||||||||||||||||||
3' ATTAACCCTCTGTCGTCTGTCTGTA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5S:50315220..50315244 25/25 Antisense target egln1.S
Chr6L:82673747..82673771 21/25 Antisense off-target LOC108705572
Chr1L:143789919..143789943 21/25 unknown
Chr3L:29170181..29170205 21/25 unknown
tropicalis 10.0 Chr5:26954052..26954076 21/25 unknown
Chr5:127254524..127254548 21/25 unknown
Publications
First: Suppression of vascular network formation by chronic hypoxia and prolyl-hydroxylase 2 (phd2) deficiency during vertebrate development., Angiogenesis 2016    
Most recent:
View All Papers