Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18006214

Morpholino Name: egln3 MO1
Synonyms: phd3 MO
Target mRNA: egln3

Morpholino Type: uncategorized morpholino
Sequence: 5' ACTCAGGATCTCTGACAGAGACAGC 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' GCTGTCTCTGTCAGAGATCCTGAGT 3'
   |||||||||||||||||||||||||
3' CGACAGAGACAGTCTCTAGGACTCA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:106661863..106661887 25/25 Antisense target egln3.L
Chr6L:57724291..57724315 22/25 Antisense off-target myrip.L
Chr9_10L:92311871..92311895 22/25 Antisense off-target plekhm3.L
Chr1S:198662446..198662470 21/25 Antisense off-target LOC108707359
Chr1S:59751188..59751212 21/25 unknown
Publications
First: Suppression of vascular network formation by chronic hypoxia and prolyl-hydroxylase 2 (phd2) deficiency during vertebrate development., Angiogenesis 2016    
Most recent:
View All Papers