Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18006331

Morpholino Name: bptf MO1
Synonyms:
Target mRNA: bptf

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CCCTGCGACCCCTCATGCTTTAGCT 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' AGCTAAAGCATGAGGGGTCGCAGGG 3'
   |||||||||||||||||||||||||
3' TCGATTTCGTACTCCCCAGCGTCCC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10S:46574414..46574438 25/25 Antisense target bptf.S
Publications
First: A PHD finger of NURF couples histone H3 lysine 4 trimethylation with chromatin remodelling., Nature 2006  
Most recent:
View All Papers