Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18018794

Morpholino Name: hace1 MO3
Synonyms: HACE1 MO2
Target mRNA: hace1

Morpholino Type: uncategorized morpholino
Sequence: 5' AGAGGCTCAGCAGTTCCTAAGCAGT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' ACTGCTTAGGAACTGCTGAGCCTCT 3'
   |||||||||||||||||||||||||
3' TGACGAATCCTTGACGACTCGGAGA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:83737379..83737403 25/25 Antisense target hace1.L
Chr4S:93649860..93649884 21/25 Antisense off-target ubn2.S
tropicalis 10.0 Chr8:35379392..35379416 21/25 unknown
Publications
First: The E3 ubiquitin ligase Hace1 is required for early embryonic development in Xenopus laevis., BMC Dev Biol 2016                      
Most recent:
View All Papers