Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18319812

Morpholino Name: marveld3 MO2
Synonyms: MD3B
Target mRNA: marveld3

Morpholino Type: uncategorized morpholino
Sequence: 5' CCCGTCTGTAACAGAATCTCTCATT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' AATGAGAGATTCTGTTACAGACGGG 3'
   |||||||||||||||||||||||||
3' TTACTCTCTAAGACAATGTCTGCCC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:52649575..52649599 25/25 Antisense target marveld3.L
tropicalis 10.0 Chr7:26071042..26071066 21/25 Antisense off-target blnk
Chr6:126964366..126964390 21/25 unknown
Publications
First: MarvelD3 regulates the c-Jun N-terminal kinase pathway during eye development in Xenopus., Biol Open 2016                            
Most recent: Control of neural crest induction by MarvelD3-mediated attenuation of JNK signalling., Sci Rep 2018                                
View All Papers