Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18328512

Morpholino Name: vps25 MO1
Synonyms:
Target mRNA: vps25

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTGTGCCCACCACACCGCTCACGT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' ACGTGAGCGGTGTGGTGGGCACAGC 3'
   |||||||||||||||||||||||||
3' TGCACTCGCCACACCACCCGTGTCG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:34250990..34251014 25/25 Antisense target vps25.L
Chr4S:120828223..120828247 21/25 unknown
Chr6L:94957836..94957860 21/25 unknown
Publications
First: ESCRT-II controls retinal axon growth by regulating DCC receptor levels and local protein synthesis., Open Biol 2016                    
Most recent:
View All Papers