Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18328513

Morpholino Name: vps25 MO2
Synonyms:
Target mRNA: vps25

Morpholino Type: uncategorized morpholino
Sequence: 5' CAACTTTCCTGGAACACAGTATGTT 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 23/25 25/25
genome
MO
5' AACATACTGTATTCCAGGAAAGCTG 3'
   |||||||||| ||||||||||| ||
3' TTGTATGACACAAGGTCCTTTCAAC 5'
5' AACATACTGTGTTCCAGGAAAGTTG 3'
   |||||||||||||||||||||||||
3' TTGTATGACACAAGGTCCTTTCAAC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10S:30385153..30385177 25/25 Antisense target vps25.S
Chr9_10L:34255038..34255062 23/25 Antisense target vps25.L
Chr6S:35124453..35124477 21/25 Antisense off-target jazf1.S
Chr8L:85425959..85425983 21/25 Sense off-target arf6.2.L
Chr9_10S:44428633..44428657 21/25 unknown
tropicalis 10.0 Chr6:85730946..85730970 21/25 Sense off-target bcl2
Publications
First: ESCRT-II controls retinal axon growth by regulating DCC receptor levels and local protein synthesis., Open Biol 2016                    
Most recent:
View All Papers