Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18328647

Morpholino Name: n4bp3 MO2
Synonyms:
Target mRNA: n4bp3

Morpholino Type: uncategorized morpholino
Sequence: 5' CACTGAAGGTCTGAGCAGCTGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 23/25 25/25
genome
MO
5' ATGGCAGCTGCTCAAACCTTCAATT 3'
   |||||||||||||| ||||||| | 
3' TACCGTCGACGAGTCTGGAAGTCAC 5'
5' ATGGCAGCTGCTCAGACCTTCAATT 3'
   |||||||||||||||||||||| | 
3' TACCGTCGACGAGTCTGGAAGTCAC 5'
5' ATGGCAGCTGCTCAGACCTTCAGTG 3'
   |||||||||||||||||||||||||
3' TACCGTCGACGAGTCTGGAAGTCAC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:99293277..99293301 25/25 Antisense target n4bp3.S
Chr3L:55104744..55104768 23/25 Antisense target n4bp3.L
tropicalis 10.0 Chr3:47790555..47790579 22/25 Antisense target n4bp3
Chr8:99759421..99759445 21/25 unknown
Publications
First: The Nedd4 binding protein 3 is required for anterior neural development in Xenopus laevis., Dev Biol 2017                              
Most recent:
View All Papers