Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18334642

Morpholino Name: best2 MO1
Synonyms: xBest-2a MO
Target mRNA: best2

Morpholino Type: uncategorized morpholino
Sequence: 5' TCACATCAAGCTTTACCTGTATATG 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' CATATACAGGTAAAGCTTGATGTGA 3'
   |||||||||||||||||||||||||
3' GTATATGTCCATTTCGAACTACACT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:149942231..149942255 25/25 Antisense target best2.L
Chr1S:197585937..197585961 21/25 Antisense off-target LOC108705540
Chr6S:80006303..80006327 21/25 unknown
tropicalis 10.0 Chr10:48997116..48997140 21/25 unknown
Chr10:48997172..48997196 21/25 unknown
Chr10:48997200..48997224 21/25 unknown
Chr10:48997340..48997364 21/25 unknown
Chr10:48997424..48997448 21/25 unknown
Publications
First: Bestrophin genes are expressed in Xenopus development., Biochem Biophys Res Commun 2009                
Most recent:
View All Papers