Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18334643

Morpholino Name: best2 MO2
Synonyms: xBest-2b MO
Target mRNA: best2

Morpholino Type: splice blocking morpholino
Sequence: 5' AGCTCCACTAAGAATTACCTGTATG 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' CATACAGGTAATTCTTAGTGGAGCT 3'
   |||||||||||||||||||||||||
3' GTATGTCCATTAAGAATCACCTCGA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:125332030..125332054 25/25 Antisense target best2.S
Chr3L:22893661..22893685 21/25 Antisense off-target cracr2a.L
Chr7L:74641574..74641598 21/25 unknown
Chr8L:72785150..72785174 21/25 unknown
tropicalis 10.0 Chr6:96746137..96746161 22/25 unknown
Publications
First: Bestrophin genes are expressed in Xenopus development., Biochem Biophys Res Commun 2009                
Most recent:
View All Papers