Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18335932

Morpholino Name: ush1c MO1
Synonyms:
Target mRNA: ush1c

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' ACTCTCTGGCTATCTTCCTCTCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genome
MO
5' ATGGAGAGGAAGATAGCCAGAGAGT 3'
   |||||||||||||||||||||||||
3' TACCTCTCCTTCTATCGGTCTCTCA 5'
5' ATGGAGAGGAAGATCGCCAGAGAGT 3'
   |||||||||||||| ||||||||||
3' TACCTCTCCTTCTATCGGTCTCTCA 5'
5' ATGGAGAGGAAGATTGCCAGAGAGT 3'
   |||||||||||||| ||||||||||
3' TACCTCTCCTTCTATCGGTCTCTCA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:281393..281417 24/25 Antisense target ush1c.L
Chr4S:23421097..23421121 24/25 Antisense target ush1c.S
Chr7L:98814950..98814974 21/25 Sense off-target tmem51.L
Chr3L:152281975..152281999 21/25 unknown
Chr6L:164178029..164178053 21/25 unknown
tropicalis 10.0 Chr4:615987..616011 25/25 Antisense target ush1c
Chr2:66013621..66013645 21/25 unknown
Chr2:68660507..68660531 21/25 unknown
Chr5:137323669..137323693 21/25 unknown
Chr6:129942153..129942177 21/25 unknown
Publications
First: Usher syndrome type 1-associated cadherins shape the photoreceptor outer segment., J Cell Biol 2017                    
Most recent:
View All Papers