Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18336940

Morpholino Name: vcan MO1
Synonyms: VsATGMO
Target mRNA: vcan

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' TCTTGACCTTTTAAGGTGACCTAGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 21/25 22/25
genome
MO
5' GCTAGGTCACCTTAAAAGGTAAATT 3'
    ||||||||||||||||||| ||  
3' TGATCCAGTGGAATTTTCCAGTTCT 5'
5' ACTAGGTCACCTTAAAAGGTAAATT 3'
   |||||||||||||||||||| ||  
3' TGATCCAGTGGAATTTTCCAGTTCT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:196908829..196908853 22/25 Antisense target vcan.L
Chr1S:169218018..169218042 21/25 Antisense off-target LOC108707243
tropicalis 10.0 Chr1:181032091..181032115 21/25 Antisense target vcan
Chr1:181032091..181032115 21/25 Sense off-target LOC105945407
Publications
First: In vivo confinement promotes collective migration of neural crest cells., J Cell Biol 2016                  
Most recent:
View All Papers