Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18336941

Morpholino Name: vcan MO2
Synonyms: VsMO1
Target mRNA: vcan

Morpholino Type: uncategorized morpholino
Sequence: 5' AAGTAAATTTGGATCTTACCTTGCA 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 21/25
genome
MO
5' TTGCAAGTAAGATCCAAATTTACTT 3'
   |   | |||||||||||||||||||
3' ACGTTCCATTCTAGGTTTAAATGAA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:196849399..196849423 21/25 Antisense target vcan.L
Chr5L:11968363..11968387 22/25 Antisense off-target flvcr1.L
Chr8S:80382591..80382615 21/25 Sense off-target syngap1.S
Publications
First: In vivo confinement promotes collective migration of neural crest cells., J Cell Biol 2016                  
Most recent:
View All Papers