Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18336942

Morpholino Name: vcan MO3
Synonyms: VsMO2
Target mRNA: vcan

Morpholino Type: uncategorized morpholino
Sequence: 5' GGGTCTTGACCTGAAATAAGACATT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 23/25 25/25
genome
MO
5' ATTGCCTTATTTCAGGTCAAGACCC 3'
   | || ||||||||||||||||||||
3' TTACAGAATAAAGTCCAGTTCTGGG 5'
5' AATGTCTTATTTCAGGTCAAGACCC 3'
   |||||||||||||||||||||||||
3' TTACAGAATAAAGTCCAGTTCTGGG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:196848655..196848679 25/25 Antisense target vcan.L
Chr6L:6968669..6968693 21/25 unknown
tropicalis 10.0 Chr1:180973393..180973417 23/25 Antisense target vcan
Chr3:69487802..69487826 21/25 Antisense off-target cped1
Publications
First: In vivo confinement promotes collective migration of neural crest cells., J Cell Biol 2016                  
Most recent:
View All Papers