Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18338806

Morpholino Name: ache MO1
Synonyms:
Target mRNA: ache

Morpholino Type: uncategorized morpholino
Sequence: 5' CATGGCTGCTCCTCTGTGGGATTAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genome
MO
5' GTAATCCCACAGAGGAGCGGCCATG 3'
   |||||||||||||||||| ||||||
3' CATTAGGGTGTCTCCTCGTCGGTAC 5'
5' GTAATCCCACAGAGGAGCAGCCATG 3'
   |||||||||||||||||||||||||
3' CATTAGGGTGTCTCCTCGTCGGTAC 5'
5' GTAATCCCACAGAGGAGTAGCCATG 3'
   ||||||||||||||||| |||||||
3' CATTAGGGTGTCTCCTCGTCGGTAC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:151548666..151548690 25/25 Antisense target ache.L
Chr3S:126664431..126664455 24/25 Antisense target ache.S
Chr5L:9217189..9217213 21/25 Sense off-target haao.L
Chr5L:9217350..9217374 21/25 Sense off-target haao.L
Chr5L:9217436..9217460 21/25 Sense off-target haao.L
Chr5L:9217507..9217531 21/25 Sense off-target haao.L
Chr5L:9217553..9217577 21/25 Sense off-target haao.L
Chr5L:9217599..9217623 21/25 Sense off-target haao.L
Chr5L:9217645..9217669 21/25 Sense off-target haao.L
Chr5L:9217688..9217712 21/25 Sense off-target haao.L
Chr5S:19967570..19967594 21/25 unknown
tropicalis 10.0 Chr3:142510270..142510294 24/25 Antisense target ache
Chr5:106660302..106660326 21/25 unknown
Publications
First: Acetylcholinesterase plays a non-neuronal, non-esterase role in organogenesis., Development 2017                      
Most recent:
View All Papers