Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18339091

Morpholino Name: vangl2 MO6
Synonyms:
Target mRNA: vangl2

Morpholino Type: uncategorized morpholino
Sequence: 5' CCTGGGTCGAAGCCAAAACTGCGAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genome
MO
5' GTCGCAGTTTTGGCTTCGACACAGG 3'
   |||||||||||||||||||| ||||
3' CAGCGTCAAAACCGAAGCTGGGTCC 5'
5' GTCGCAGTTTTGGCTTCGACCCAGG 3'
   |||||||||||||||||||||||||
3' CAGCGTCAAAACCGAAGCTGGGTCC 5'
5' GTTGCAGTTTTGGCTTCGACCCAGG 3'
   || ||||||||||||||||||||||
3' CAGCGTCAAAACCGAAGCTGGGTCC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:127346581..127346605 25/25 Antisense target vangl2.L
Chr8S:99085674..99085698 24/25 Antisense target vangl2.S
tropicalis 10.0 Chr8:137136644..137136668 24/25 Antisense target vangl2
Publications
First: hmmr mediates anterior neural tube closure and morphogenesis in the frog Xenopus., Dev Biol 2017                        
Most recent:
View All Papers