Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18373829

Morpholino Name: nek8 MO1
Synonyms: nek8 MO
Target mRNA: nek8

Morpholino Type: uncategorized morpholino
Sequence: 5' CCCGGATCTTCTTGTATTTCTCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 25/25
genome
MO
5' ATGGAGAAATACAAGAAGATCCGGG 3'
   |||||||||||||||||||||||||
3' TACCTCTTTATGTTCTTCTAGGCCC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2S:4099845..4099869 25/25 unknown
Chr6L:83641468..83641492 22/25 unknown
Chr1L:96256480..96256504 21/25 unknown
Chr4S:98862905..98862929 21/25 unknown
tropicalis 10.0 Chr2:34310080..34310104 25/25 Antisense target nek8
Chr3:134600557..134600581 21/25 Antisense off-target adgre5
Publications
First: ANKS6 is a central component of a nephronophthisis module linking NEK8 to INVS and NPHP3., Nat Genet 2013                                  
Most recent:
View All Papers