Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18373971

Morpholino Name: vgll3 MO1
Synonyms:
Target mRNA: vgll3

Morpholino Type: uncategorized morpholino
Sequence: 5' CGCAGAACTGCTGTCTAGTGGCACC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 21/25 25/25
genome
MO
5' GGTGACACTGGCCAGCAGTTCTGCA 3'
   |||| |||| | |||||||||||| 
3' CCACGGTGATCTGTCGTCAAGACGC 5'
5' GGTGCCACTAGACAGCAGTTCTGCG 3'
   |||||||||||||||||||||||||
3' CCACGGTGATCTGTCGTCAAGACGC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:22107795..22107819 25/25 Antisense target vgll3.L
Chr7L:111945964..111945988 22/25 Antisense off-target arhgef1.L
Chr7L:136855437..136855461 21/25 unknown
tropicalis 10.0 Chr2:22926818..22926842 21/25 Antisense target vgll3
Publications
First: Vestigial-like 3 is a novel Ets1 interacting partner and regulates trigeminal nerve formation and cranial neural crest migration., Biol Open 2017                                    
Most recent:
View All Papers