Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18373972

Morpholino Name: vgll3 MO2
Synonyms: v3LMOe2i2 (v3LMOsp)
Target mRNA: vgll3

Morpholino Type: splice blocking morpholino (E2-I2)
Sequence: 5' GAGAAGCCATATTTGCTTACCCCTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 22/25 25/25
genome
MO
5' GAAGGGTAAGCAAACATTGCTTCTC 3'
   || ||||||||||| || |||||||
3' CTCCCCATTCGTTTATACCGAAGAG 5'
5' GAGGGGTAAGCAAATATGGCTTCTC 3'
   |||||||||||||||||||||||||
3' CTCCCCATTCGTTTATACCGAAGAG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:22115612..22115636 25/25 Antisense target vgll3.L
Chr1S:95410926..95410950 21/25 Sense off-target safb.S
Chr4L:145300017..145300041 21/25 Antisense off-target magi1.L
Chr6L:112974587..112974611 21/25 Antisense off-target epb41l3.L
Chr1S:44669863..44669887 21/25 unknown
Chr2L:75977796..75977820 21/25 unknown
Chr6L:132640330..132640354 21/25 unknown
Chr6L:81428978..81429002 21/25 unknown
Chr8L:82520901..82520925 21/25 unknown
Chr9_10L:1182906..1182930 21/25 unknown
tropicalis 10.0 Chr2:22934830..22934854 22/25 Antisense target vgll3
Publications
First: Vestigial-like 3 is a novel Ets1 interacting partner and regulates trigeminal nerve formation and cranial neural crest migration., Biol Open 2017                                    
Most recent:
View All Papers