Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18373975

Morpholino Name: vgll3 MO4
Synonyms: v3MO2
Target mRNA: vgll3

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTACATAAGATCCAGACAACTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 25/25
genome
MO
5' ATGAGTTGTCTGGATCTTATGTACC 3'
   |||||||||||||||||||||||||
3' TACTCAACAGACCTAGAATACATGG 5'
5' ATGAGTTGTCTGGATCTTATGTACC 3'
   |||||||||||||||||||||||||
3' TACTCAACAGACCTAGAATACATGG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:22107855..22107879 25/25 Antisense target vgll3.L
Chr2S:13148612..13148636 25/25 Antisense off-target LOC108709205
tropicalis 10.0 Chr2:22926894..22926918 25/25 Antisense target vgll3
Publications
First: Vestigial-like 3 is a novel Ets1 interacting partner and regulates trigeminal nerve formation and cranial neural crest migration., Biol Open 2017                                    
Most recent:
View All Papers