Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18374128

Morpholino Name: neil1 MO1
Synonyms:
Target mRNA: neil1

Morpholino Type: uncategorized morpholino
Sequence: 5' GAAGCTCCGGACCCTCAGGCATAGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 24/25 24/25
genome
MO
5' GATATGCCTGAGGGTCCGGAGCTTC 3'
   | |||||||||||||||||||||||
3' CGATACGGACTCCCAGGCCTCGAAG 5'
5' GCTATGCCTGAGGGTCCAGAGCTTC 3'
   ||||||||||||||||| |||||||
3' CGATACGGACTCCCAGGCCTCGAAG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:100574457..100574481 24/25 Antisense target neil1.L
tropicalis 10.0 Chr3:95125205..95125229 24/25 Antisense target neil1
Publications
First: Neil DNA glycosylases promote substrate turnover by Tdg during DNA demethylation., Nat Struct Mol Biol 2016                  
Most recent:
View All Papers