Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18374130

Morpholino Name: neil2 MO2
Synonyms:
Target mRNA: neil2

Morpholino Type: uncategorized morpholino
Sequence: 5' CATGTCTGCGGCCTTCATCAGAGGA 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 21/25
genome
MO
5' TCCTCTGATGAAGGCCGCAGGTAAA 3'
   ||||||||||||||||||||  |  
3' AGGAGACTACTTCCGGCGTCTGTAC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:162172782..162172806 21/25 Antisense target neil2.L
Publications
First: Neil DNA glycosylases promote substrate turnover by Tdg during DNA demethylation., Nat Struct Mol Biol 2016                  
Most recent:
View All Papers