Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18375113

Morpholino Name: uchl5 MO1
Synonyms: Uch37
Target mRNA: uchl5

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' ACCATTCTCCTGCACTGCCCGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genome
MO
5' ATGGCGGGCAGTGCGGGAGAATGGT 3'
   |||||||||||||| ||||||||||
3' TACCGCCCGTCACGTCCTCTTACCA 5'
5' ATGGCGGGCAGTGCAGGAGAATGGT 3'
   |||||||||||||||||||||||||
3' TACCGCCCGTCACGTCCTCTTACCA 5'
5' ATGGCGGGCAGTGCTGGAGAATGGT 3'
   |||||||||||||| ||||||||||
3' TACCGCCCGTCACGTCCTCTTACCA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:115301818..115301842 25/25 Antisense target uchl5.L
Chr4S:96761612..96761636 24/25 Antisense target uchl5.S
tropicalis 10.0 Chr4:117838993..117839017 24/25 Antisense target uchl5
Chr6:146911798..146911822 21/25 Antisense off-target slc45a4
Chr2:99874594..99874618 21/25 unknown
Chr8:40912517..40912541 21/25 unknown
Publications
First: Ubiquitin C-terminal hydrolase37 regulates Tcf7 DNA binding for the activation of Wnt signalling., Sci Rep 2017                          
Most recent:
View All Papers