Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18385577

Morpholino Name: elmo2 MO1
Synonyms: elmo1
Target mRNA: elmo2

Morpholino Type: translation blocking morpholino
Sequence: 5' GCGGCATTGTCCTTTCTGTGGTTAT 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:67660571..67660595 25/25 Antisense off-target elmo1.L
Chr3L:144125325..144125349 21/25 unknown
Publications
First: The Rac1 regulator ELMO controls basal body migration and docking in multiciliated cells through interaction with Ezrin., Development 2015                                              
Most recent:
View All Papers