Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18396232

Morpholino Name: acvrl1 MO1
Synonyms: ALK1 MO, ALK1MO
Target mRNA: acvrl1

Morpholino Type: uncategorized morpholino
Sequence: 5' GTTTTCAGGTGACACAGGAGCAGCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25 24/25
genome
MO
5' AGCTGCTTCTCTATCACCTGAAAAC 3'
   ||||||| || | ||||||||||||
3' TCGACGAGGACACAGTGGACTTTTG 5'
5' AGCTGCTCCTGTGTCACCTGAAAAC 3'
   |||||||||||||||||||||||||
3' TCGACGAGGACACAGTGGACTTTTG 5'
5' AGCTGCTTCTGTGTCACCTGAAAAC 3'
   ||||||| |||||||||||||||||
3' TCGACGAGGACACAGTGGACTTTTG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:141580443..141580467 25/25 Antisense target acvrl1.L
Chr2S:126587418..126587442 24/25 Antisense target acvrl1.S
Chr5S:29254964..29254988 23/25 Sense off-target rin2.S
Chr8L:2517196..2517220 21/25 Sense off-target LOC108698158
Chr1L:17528493..17528517 21/25 unknown
Chr5S:70741537..70741561 21/25 unknown
Chr6S:100207516..100207540 21/25 unknown
tropicalis 10.0 Chr2:135075183..135075207 22/25 Antisense target acvrl1
Publications
First: ADMP controls the size of Spemann's organizer through a network of self-regulating expansion-restriction signals., BMC Biol 2018                  
Most recent:
View All Papers