Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18396233

Morpholino Name: acvr1 MO1
Synonyms: ALK2 MO, ALK2MO
Target mRNA: acvr1

Morpholino Type: uncategorized morpholino
Sequence: 5' GAAGAATCATAACACCATCCACCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' ATGGTGGATGGTGTTATGATTCTTC 3'
   |||||||||||||||||||||||||
3' TACCACCTACCACAATACTAAGAAG 5'
5' ATGGTGGATGGTGTTATGATTCTTC 3'
   |||||||||||||||||||||||||
3' TACCACCTACCACAATACTAAGAAG 5'
5' ATGGTGGATGGTGTTATGATTCTTC 3'
   |||||||||||||||||||||||||
3' TACCACCTACCACAATACTAAGAAG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:70479617..70479641 25/25 Antisense target acvr1.L
Chr9_10S:61743630..61743654 25/25 Antisense target acvr1.S
tropicalis 10.0 Chr9:73915150..73915174 25/25 Antisense target acvr1
Chr3:111011677..111011701 21/25 unknown
Publications
First: ADMP controls the size of Spemann's organizer through a network of self-regulating expansion-restriction signals., BMC Biol 2018                  
Most recent:
View All Papers