Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18396310

Morpholino Name: sema3a MO3
Synonyms:
Target mRNA: sema3a

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GCAATCCAGGTCAGAGAGCCCATGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genome
MO
5' GCATGGGCTCTCCGACCTGGATTGC 3'
   |||||||||||| ||||||||||||
3' CGTACCCGAGAGACTGGACCTAACG 5'
5' GCATGGGCTCTCTGACCTGGATTGC 3'
   |||||||||||||||||||||||||
3' CGTACCCGAGAGACTGGACCTAACG 5'
5' GCATGGGCTCTCTGACCTGGATTGC 3'
   |||||||||||||||||||||||||
3' CGTACCCGAGAGACTGGACCTAACG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:86246009..86246033 25/25 Antisense target sema3a.L
Chr3S:70695472..70695496 25/25 Antisense target sema3a.S
Chr8S:43662408..43662432 22/25 unknown
tropicalis 10.0 Chr3:80346484..80346508 24/25 Antisense target sema3a
Chr7:127508366..127508390 21/25 unknown
Publications
First: Sema3a plays a role in the pathogenesis of CHARGE syndrome., Hum Mol Genet 2018    
Most recent:
View All Papers