Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18396909

Morpholino Name: enkur MO1
Synonyms: enkurin MO
Target mRNA: enkur

Morpholino Type: splice blocking morpholino
Sequence: 5' AATGACTATCCACTTACTTTCAGCC 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' GGCTGAAAGTAAGTGGATAGTCATT 3'
   |||||||||||||||||||||||||
3' CCGACTTTCATTCACCTATCAGTAA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:24956597..24956621 25/25 Antisense target enkur.L
Publications
First: Evolutionary Proteomics Uncovers Ancient Associations of Cilia with Signaling Pathways., Dev Cell 2017        
Most recent:
View All Papers