Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-19776740

Morpholino Name: hdac1 MO2
Synonyms:
Target mRNA: hdac1

Morpholino Type: translation blocking morpholino
Sequence: 5' GAGTCAGCGCCATTTTCCTTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 20/21 21/21 20/21
genome
MO
5' GAAGGAAAATGGCGCTGAGTC 3'
   |||||||||||||||||| ||
3' CTTCCTTTTACCGCGACTGAG 5'
5' GAAGGAAAATGGCGCTGACTC 3'
   |||||||||||||||||||||
3' CTTCCTTTTACCGCGACTGAG 5'
5' GAAGGAAAATGGCGCTGAGTC 3'
   |||||||||||||||||| ||
3' CTTCCTTTTACCGCGACTGAG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:89729989..89730009 21/21 Antisense target hdac1.L
Chr2S:77901109..77901129 20/21 Antisense target hdac1.S
Chr8S:28781221..28781241 18/21 Sense off-target ubac1.S
Chr3L:54174116..54174136 18/21 Antisense off-target LOC108710982
Chr4L:108893850..108893870 18/21 Sense off-target LOC108713550
Chr7S:44585111..44585131 18/21 Sense off-target LOC108703376
Chr1S:99705051..99705071 19/21 unknown
Chr5L:105654983..105655003 18/21 unknown
Chr9_10L:26354492..26354512 18/21 unknown
Chr9_10S:102916223..102916243 18/21 unknown
tropicalis 10.0 Chr2:86432192..86432212 20/21 Antisense target hdac1
Chr7:74437744..74437764 18/21 Antisense off-target pknox2
Chr6:85954426..85954446 18/21 Antisense off-target serpinb5
Chr8:78071592..78071612 18/21 Sense off-target LOC733726
Chr9:61640625..61640645 18/21 Antisense off-target LOC116407676
Chr8:104069572..104069592 18/21 unknown
Chr5:45796278..45796298 17/21 unknown
Publications
First: Histone deacetylase activity has an essential role in establishing and maintaining the vertebrate neural crest., Development 2018                            
Most recent:
View All Papers