Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-19778020

Morpholino Name: hdac2 MO1
Synonyms:
Target mRNA: hdac2

Morpholino Type: uncategorized morpholino
Sequence: 5' ATACGCCATGAAGAGCCCTGGAACC 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' GGTTCCAGGGCTCTTCATGGCGTAT 3'
   |||||||||||||||||||||||||
3' CCAAGGTCCCGAGAAGTACCGCATA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5S:55869863..55869887 25/25 Antisense target hdac2.S
Chr6S:10235308..10235332 21/25 Antisense off-target LOC108719662
Publications
First: A novel role for Ascl1 in the regulation of mesendoderm formation via HDAC-dependent antagonism of VegT., Development 2016                              
Most recent:
View All Papers