Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22063231

Morpholino Name: eif2ak3 MO1
Synonyms: PERK MO
Target mRNA: eif2ak3

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CGAACACTTTCACCTCATAACACTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 22/25 25/25
genome
MO
5' AAGTGTTATGAGGTGAAGGTGTTGC 3'
   ||||||||||||||||| |||||  
3' TTCACAATACTCCACTTTCACAAGC 5'
5' AAGTGTTATGAGGTGAAAGTGTTCG 3'
   |||||||||||||||||||||||||
3' TTCACAATACTCCACTTTCACAAGC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1S:9514664..9514688 25/25 Antisense target eif2ak3.S
Chr1L:18596453..18596477 25/25 Antisense off-target LOC108697591
tropicalis 10.0 Chr1:18067278..18067302 22/25 Antisense target eif2ak3
Chr7:56825425..56825449 21/25 Sense off-target mrpl16
Publications
First: Noncanonical Modulation of the eIF2 Pathway Controls an Increase in Local Translation during Neural Wiring., Mol Cell 2019                  
Most recent:
View All Papers