Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22063281

Morpholino Name: adam12 MO1
Synonyms: 12-1
Target mRNA: adam12

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CTCTGCTCTGAGACTCTCTGACATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genome
MO
5' GATGTCAGAGAGTCTCAGAGCAGAG 3'
   |||||||||||||||||||||||||
3' CTACAGTCTCTCAGAGTCTCGTCTC 5'
5' GATGTCAGAGAGTCTCGGAGCAGAG 3'
   |||||||||||||||| ||||||||
3' CTACAGTCTCTCAGAGTCTCGTCTC 5'
5' GATGTCAGAGAGTCTCGGAGCAGAG 3'
   |||||||||||||||| ||||||||
3' CTACAGTCTCTCAGAGTCTCGTCTC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:19292446..19292470 24/25 Antisense target adam12.L
Chr7S:15040944..15040968 24/25 Antisense target adam12.S
Chr2L:109854275..109854299 21/25 Antisense off-target gpm6b.L
Chr7S:34422112..34422136 21/25 unknown
Chr9_10L:64641107..64641131 21/25 unknown
tropicalis 10.0 Chr7:24607961..24607985 25/25 Antisense target adam12
Publications
First: Xenopus ADAM19 regulates Wnt signaling and neural crest specification by stabilizing ADAM13., Development 2018                          
Most recent:
View All Papers