Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22063282

Morpholino Name: adam19 MO3
Synonyms: 19-2
Target mRNA: adam19

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' GCCCTCTCCCTGGCTTTTCTCTAAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 25/25
genome
MO
5' CTTAGAGAAAAGCCAGGGAGAGGGC 3'
   |||||||||||||||||||||||||
3' GAATCTCTTTTCGGTCCCTCTCCCG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:24795954..24795978 21/25 Antisense off-target ttbk1.L
Chr7S:41569246..41569270 21/25 Sense off-target LOC108703350
tropicalis 10.0 Chr3:14040965..14040989 25/25 Antisense target adam19
Chr8:114038092..114038116 22/25 Antisense off-target pla2g4f
Chr5:81996789..81996813 21/25 Antisense off-target prdm13
Chr1:136555493..136555517 21/25 unknown
Chr3:28878327..28878351 21/25 unknown
Publications
First: Xenopus ADAM19 regulates Wnt signaling and neural crest specification by stabilizing ADAM13., Development 2018                          
Most recent:
View All Papers