Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22063283

Morpholino Name: adam19 MO4
Synonyms: 19-1
Target mRNA: adam19

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CATACGAGTCCTGTAGCTCCTTCCATCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 28/28 25/28
genome
MO
5' GGATGGAAGGAGCTACAGGACTCGTATG 3'
   ||||||||||||||||||||||||||||
3' CCTACCTTCCTCGATGTCCTGAGCATAC 5'
5' GGATGGAAGGAGCTACAGGACTCCCCTG 3'
   |||||||||||||||||||||||   ||
3' CCTACCTTCCTCGATGTCCTGAGCATAC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:10396487..10396514 25/28 Antisense target adam19.S
tropicalis 10.0 Chr3:14040925..14040952 28/28 Antisense target adam19
Publications
First: Xenopus ADAM19 regulates Wnt signaling and neural crest specification by stabilizing ADAM13., Development 2018                          
Most recent:
View All Papers