Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22064111

Morpholino Name: nagk MO1
Synonyms:
Target mRNA: nagk

Morpholino Type: uncategorized morpholino
Sequence: 5' CCCCCATACACAGCAGCCATCTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 21/23 23/23
genome
MO
5' GCGATGGCGGCTGTGTATGGGGG 3'
   | |||||| ||||||||||||||
3' CTCTACCGACGACACATACCCCC 5'
5' GAGATGGCTGCTGTGTATGGGGG 3'
   |||||||||||||||||||||||
3' CTCTACCGACGACACATACCCCC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:12100198..12100220 23/23 Antisense target nagk.L
Chr5S:135534816..135534838 21/23 Antisense off-target mmut.S
Chr3S:74346904..74346926 20/23 Sense off-target LOC108713084
Chr2L:23625250..23625272 19/23 Antisense off-target gbe1.L
Chr3L:149937289..149937311 19/23 Sense off-target best2.L
Chr3S:10997512..10997534 19/23 Antisense off-target il12b.S
Chr8L:11185377..11185399 19/23 Antisense off-target kdm5c.L
Chr8S:34817142..34817164 19/23 Antisense off-target kdm5c.S
Chr8S:17905617..17905639 19/23 Antisense off-target bcl11b.S
Chr7L:61031435..61031457 19/23 Sense off-target slc43a1.L
Chr1S:30358011..30358033 19/23 Antisense off-target LOC108706599
Chr5S:12178167..12178189 19/23 Antisense off-target LOC108717690
Chr4S:122599509..122599531 20/23 unknown
Chr3L:130850346..130850368 19/23 unknown
Chr3S:30236920..30236942 19/23 unknown
Chr6L:51692590..51692612 19/23 unknown
Chr9_10S:7011988..7012010 19/23 unknown
tropicalis 10.0 Chr1:14542545..14542567 21/23 Antisense target nagk
Chr5:92138870..92138892 21/23 Sense off-target kcnq5
Chr3:13588638..13588660 20/23 Sense off-target ebf4
Chr3:136176568..136176590 20/23 Sense off-target dsn1
Chr3:141245278..141245300 20/23 Antisense off-target mri1
Chr4:13373071..13373093 20/23 Sense off-target dgkz
Chr4:13373158..13373180 20/23 Sense off-target dgkz
Chr5:140380109..140380131 20/23 Sense off-target nbas
Chr6:9530319..9530341 20/23 Antisense off-target gjc2
Chr6:9530231..9530253 20/23 Antisense off-target gjc2
Chr9:83697237..83697259 20/23 Antisense off-target speg
Chr1:78360400..78360422 20/23 Antisense off-target mmrn1
Chr10:15689697..15689719 20/23 Sense off-target scn4a
Chr2:148865781..148865803 20/23 Antisense off-target cox14
Chr2:95743565..95743587 20/23 Antisense off-target doc2b
Chr5:9684598..9684620 20/23 Sense off-target taf1a
Chr5:92138642..92138664 20/23 Sense off-target kcnq5
Chr5:92139000..92139022 20/23 Sense off-target kcnq5
Chr5:92139073..92139095 20/23 Sense off-target kcnq5
Chr9:69046566..69046588 20/23 Antisense off-target cers6
Chr1:24770386..24770408 20/23 Antisense off-target sorcs2
Chr2:116323123..116323145 20/23 Sense off-target atp11a
Chr2:64143831..64143853 20/23 Sense off-target anks1a
Chr4:48156981..48157003 20/23 Sense off-target necab2
Chr4:48156999..48157021 20/23 Sense off-target necab2
Chr5:92654785..92654807 20/23 Sense off-target ogfrl1
Chr6:28233646..28233668 20/23 Sense off-target cacnb2
Chr6:28233664..28233686 20/23 Sense off-target cacnb2
Chr8:52099592..52099614 20/23 Sense off-target lhfpl1
Chr1:844693..844715 20/23 Antisense off-target LOC116408329
Chr3:138512903..138512925 20/23 Sense off-target LOC100380178
Chr3:138512984..138513006 20/23 Sense off-target LOC100380178
Chr3:141153529..141153551 20/23 Antisense off-target LOC100497605
Chr3:141153597..141153619 20/23 Antisense off-target LOC100497605
Chr3:141153665..141153687 20/23 Antisense off-target LOC100497605
Chr4:152428278..152428300 20/23 Sense off-target LOC116410519
Chr4:152428313..152428335 20/23 Sense off-target LOC116410519
Chr4:152428331..152428353 20/23 Sense off-target LOC116410519
Chr4:152428416..152428438 20/23 Sense off-target LOC116410519
Chr4:152428434..152428456 20/23 Sense off-target LOC116410519
Chr4:152428452..152428474 20/23 Sense off-target LOC116410519
Chr4:152428520..152428542 20/23 Sense off-target LOC116410519
Chr4:152428538..152428560 20/23 Sense off-target LOC116410519
Chr4:152428590..152428612 20/23 Sense off-target LOC116410519
Chr4:152428608..152428630 20/23 Sense off-target LOC116410519
Chr4:152428659..152428681 20/23 Sense off-target LOC116410519
Chr4:152428677..152428699 20/23 Sense off-target LOC116410519
Chr4:152428783..152428805 20/23 Sense off-target LOC116410519
Chr4:152428869..152428891 20/23 Sense off-target LOC116410519
Chr4:152428956..152428978 20/23 Sense off-target LOC116410519
Chr4:152429314..152429336 20/23 Sense off-target LOC116410519
Chr4:152429585..152429607 20/23 Sense off-target LOC116410519
Chr4:152429754..152429776 20/23 Sense off-target LOC116410519
Chr4:152428398..152428420 20/23 Sense off-target LOC116410519
Chr5:32072915..32072937 20/23 Antisense off-target LOC116410856
Chr5:32469598..32469620 20/23 Sense off-target LOC100491791
Chr6:2320602..2320624 20/23 Sense off-target LOC100486918
Chr6:64762927..64762949 20/23 Sense off-target LOC100489129
Chr6:64762981..64763003 20/23 Sense off-target LOC100489129
Chr7:5959305..5959327 20/23 Antisense off-target LOC101730242
Chr7:5959357..5959379 20/23 Antisense off-target LOC101730242
Chr7:5959444..5959466 20/23 Antisense off-target LOC101730242
Chr7:5959462..5959484 20/23 Antisense off-target LOC101730242
Chr7:5959498..5959520 20/23 Antisense off-target LOC101730242
Chr7:5959516..5959538 20/23 Antisense off-target LOC101730242
Chr7:5959621..5959643 20/23 Antisense off-target LOC101730242
Chr7:5959639..5959661 20/23 Antisense off-target LOC101730242
Chr7:5960017..5960039 20/23 Antisense off-target LOC101730242
Chr7:5960232..5960254 20/23 Antisense off-target LOC101730242
Chr7:5960250..5960272 20/23 Antisense off-target LOC101730242
Chr8:136352990..136353012 20/23 Antisense off-target LOC105945582
Chr8:136353008..136353030 20/23 Antisense off-target LOC105945582
Chr8:136353131..136353153 20/23 Antisense off-target LOC105945582
Chr8:136353394..136353416 20/23 Antisense off-target LOC105945582
Chr8:136353465..136353487 20/23 Antisense off-target LOC105945582
Chr8:136353483..136353505 20/23 Antisense off-target LOC105945582
Chr9:1537548..1537570 20/23 Sense off-target LOC101732019
Chr9:1537566..1537588 20/23 Sense off-target LOC101732019
Chr9:1537584..1537606 20/23 Sense off-target LOC101732019
Chr2:12213044..12213066 19/23 Antisense off-target erg
Chr2:12213112..12213134 19/23 Antisense off-target erg
Chr2:12213228..12213250 19/23 Antisense off-target erg
Chr2:12213375..12213397 19/23 Antisense off-target erg
Chr2:12213476..12213498 19/23 Antisense off-target erg
Chr2:12213688..12213710 19/23 Antisense off-target erg
Chr2:12213789..12213811 19/23 Antisense off-target erg
Chr5:36380289..36380311 19/23 Sense off-target kiz
Chr5:36380338..36380360 19/23 Sense off-target kiz
Chr5:36380391..36380413 19/23 Sense off-target kiz
Chr5:36380556..36380578 19/23 Sense off-target kiz
Chr1:141479219..141479241 19/23 Sense off-target trac
Chr1:141479413..141479435 19/23 Sense off-target trac
Chr1:141479650..141479672 19/23 Sense off-target trac
Chr1:141662770..141662792 19/23 Sense off-target trac
Chr1:141678381..141678403 19/23 Antisense off-target trac
Chr1:196811544..196811566 19/23 Antisense off-target fyb1
Chr1:196811623..196811645 19/23 Antisense off-target fyb1
Chr1:196811781..196811803 19/23 Antisense off-target fyb1
Chr1:196811875..196811897 19/23 Antisense off-target fyb1
Chr1:94088849..94088871 19/23 Antisense off-target ebi3
Chr2:56059642..56059664 19/23 Antisense off-target maob
Chr2:56059509..56059531 19/23 Antisense off-target maob
Chr2:56059771..56059793 19/23 Antisense off-target maob
Chr2:56059819..56059841 19/23 Antisense off-target maob
Chr3:13588329..13588351 19/23 Sense off-target ebf4
Chr3:13588414..13588436 19/23 Sense off-target ebf4
Chr3:13588466..13588488 19/23 Sense off-target ebf4
Chr3:13588517..13588539 19/23 Sense off-target ebf4
Chr3:13588570..13588592 19/23 Sense off-target ebf4
Chr3:13588688..13588710 19/23 Sense off-target ebf4
Chr3:13588739..13588761 19/23 Sense off-target ebf4
Chr3:13588773..13588795 19/23 Sense off-target ebf4
Chr3:13588869..13588891 19/23 Sense off-target ebf4
Chr3:13588918..13588940 19/23 Sense off-target ebf4
Chr3:136176534..136176556 19/23 Sense off-target dsn1
Chr3:141245244..141245266 19/23 Antisense off-target mri1
Chr3:141245314..141245336 19/23 Antisense off-target mri1
Chr3:141245347..141245369 19/23 Antisense off-target mri1
Chr3:141245380..141245402 19/23 Antisense off-target mri1
Chr3:141245430..141245452 19/23 Antisense off-target mri1
Chr3:141245463..141245485 19/23 Antisense off-target mri1
Chr3:141245545..141245567 19/23 Antisense off-target mri1
Chr3:141245577..141245599 19/23 Antisense off-target mri1
Chr3:141245610..141245632 19/23 Antisense off-target mri1
Chr3:141245659..141245681 19/23 Antisense off-target mri1
Chr3:141245691..141245713 19/23 Antisense off-target mri1
Chr3:141245725..141245747 19/23 Antisense off-target mri1
Chr3:141245876..141245898 19/23 Antisense off-target mri1
Chr3:141245987..141246009 19/23 Antisense off-target mri1
Chr3:141246020..141246042 19/23 Antisense off-target mri1
Chr3:141246054..141246076 19/23 Antisense off-target mri1
Chr3:141246088..141246110 19/23 Antisense off-target mri1
Chr3:141246153..141246175 19/23 Antisense off-target mri1
Chr3:141246187..141246209 19/23 Antisense off-target mri1
Chr3:141245497..141245519 19/23 Antisense off-target mri1
Chr3:95445750..95445772 19/23 Sense off-target sord
Chr4:13372931..13372953 19/23 Sense off-target dgkz
Chr4:150518637..150518659 19/23 Sense off-target chdh
Chr5:123816350..123816372 19/23 Sense off-target cul3
Chr5:123816384..123816406 19/23 Sense off-target cul3
Chr5:123816601..123816623 19/23 Sense off-target cul3
Chr5:162725890..162725912 19/23 Sense off-target gckr
Chr5:162725955..162725977 19/23 Sense off-target gckr
Chr5:25067911..25067933 19/23 Sense off-target chgb
Chr6:111919089..111919111 19/23 Sense off-target mcm3
Chr6:9530406..9530428 19/23 Antisense off-target gjc2
Chr6:9530498..9530520 19/23 Antisense off-target gjc2
Chr6:9530585..9530607 19/23 Antisense off-target gjc2
Chr6:9530212..9530234 19/23 Antisense off-target gjc2
Chr7:12826297..12826319 19/23 Sense off-target rnls
Chr7:12826361..12826383 19/23 Sense off-target rnls
Chr7:12826481..12826503 19/23 Sense off-target rnls
Chr7:12826562..12826584 19/23 Sense off-target rnls
Chr9:83697410..83697432 19/23 Antisense off-target speg
Chr9:83697429..83697451 19/23 Antisense off-target speg
Chr1:103586744..103586766 19/23 Sense off-target pde4c
Chr1:109841589..109841611 19/23 Antisense off-target rnf38
Chr1:109866498..109866520 19/23 Antisense off-target rnf38
Chr1:109866548..109866570 19/23 Antisense off-target rnf38
Chr1:109866599..109866621 19/23 Antisense off-target rnf38
Chr1:109866648..109866670 19/23 Antisense off-target rnf38
Chr1:109866791..109866813 19/23 Antisense off-target rnf38
Chr1:109866838..109866860 19/23 Antisense off-target rnf38
Chr1:161416297..161416319 19/23 Antisense off-target abcb9
Chr1:161416379..161416401 19/23 Antisense off-target abcb9
Chr1:162536943..162536965 19/23 Antisense off-target p2rx7
Chr1:162537022..162537044 19/23 Antisense off-target p2rx7
Chr1:162537519..162537541 19/23 Sense off-target p2rx7
Chr1:19302128..19302150 19/23 Sense off-target ctbp1
Chr1:19302212..19302234 19/23 Sense off-target ctbp1
Chr1:19302339..19302361 19/23 Sense off-target ctbp1
Chr1:19302419..19302441 19/23 Sense off-target ctbp1
Chr1:19302602..19302624 19/23 Sense off-target ctbp1
Chr1:19302703..19302725 19/23 Sense off-target ctbp1
Chr1:19306203..19306225 19/23 Antisense off-target ctbp1
Chr1:19306235..19306257 19/23 Antisense off-target ctbp1
Chr1:19306297..19306319 19/23 Antisense off-target ctbp1
Chr1:19306409..19306431 19/23 Antisense off-target ctbp1
Chr1:19306469..19306491 19/23 Antisense off-target ctbp1
Chr1:19306565..19306587 19/23 Antisense off-target ctbp1
Chr1:19306598..19306620 19/23 Antisense off-target ctbp1
Chr1:19399066..19399088 19/23 Antisense off-target ctbp1
Chr1:19399117..19399139 19/23 Antisense off-target ctbp1
Chr1:19399186..19399208 19/23 Antisense off-target ctbp1
Chr1:19399249..19399271 19/23 Antisense off-target ctbp1
Chr1:19306729..19306751 19/23 Antisense off-target ctbp1
Chr1:19306829..19306851 19/23 Antisense off-target ctbp1
Chr1:19306962..19306984 19/23 Antisense off-target ctbp1
Chr1:19399021..19399043 19/23 Antisense off-target ctbp1
Chr1:206721333..206721355 19/23 Sense off-target haus1
Chr1:206721114..206721136 19/23 Sense off-target haus1
Chr1:206721148..206721170 19/23 Sense off-target haus1
Chr1:206721266..206721288 19/23 Sense off-target haus1
Chr1:78360078..78360100 19/23 Antisense off-target mmrn1
Chr1:78360112..78360134 19/23 Antisense off-target mmrn1
Chr1:78360180..78360202 19/23 Antisense off-target mmrn1
Chr1:78360247..78360269 19/23 Antisense off-target mmrn1
Chr1:78360281..78360303 19/23 Antisense off-target mmrn1
Chr1:78360534..78360556 19/23 Antisense off-target mmrn1
Chr1:78360585..78360607 19/23 Antisense off-target mmrn1
Chr1:78360619..78360641 19/23 Antisense off-target mmrn1
Chr1:79634875..79634897 19/23 Antisense off-target parm1
Chr1:79634923..79634945 19/23 Antisense off-target parm1
Chr1:79635020..79635042 19/23 Antisense off-target parm1
Chr1:79635186..79635208 19/23 Antisense off-target parm1
Chr10:38315520..38315542 19/23 Sense off-target kcnb1
Chr10:38315699..38315721 19/23 Sense off-target kcnb1
Chr1:99840751..99840773 19/23 Sense off-target efna2
Chr10:15689612..15689634 19/23 Sense off-target scn4a
Chr10:38315265..38315287 19/23 Sense off-target kcnb1
Chr10:38315315..38315337 19/23 Sense off-target kcnb1
Chr10:38315417..38315439 19/23 Sense off-target kcnb1
Chr2:112612714..112612736 19/23 Sense off-target eif5b
Chr2:120956033..120956055 19/23 Antisense off-target clybl
Chr2:12441003..12441025 19/23 Sense off-target kcnj6
Chr2:12441054..12441076 19/23 Sense off-target kcnj6
Chr2:12441088..12441110 19/23 Sense off-target kcnj6
Chr2:12441121..12441143 19/23 Sense off-target kcnj6
Chr2:12441155..12441177 19/23 Sense off-target kcnj6
Chr2:12441255..12441277 19/23 Sense off-target kcnj6
Chr2:12441356..12441378 19/23 Sense off-target kcnj6
Chr2:12441423..12441445 19/23 Sense off-target kcnj6
Chr2:134490318..134490340 19/23 Sense off-target lrch1
Chr2:152091426..152091448 19/23 Sense off-target dclk1
Chr2:142688532..142688554 19/23 Sense off-target tankl
Chr2:152091558..152091580 19/23 Sense off-target dclk1
Chr2:152091591..152091613 19/23 Sense off-target dclk1
Chr2:16380476..16380498 19/23 Sense off-target grik1
Chr2:16380538..16380560 19/23 Sense off-target grik1
Chr2:16380572..16380594 19/23 Sense off-target grik1
Chr2:16380606..16380628 19/23 Sense off-target grik1
Chr3:109586426..109586448 19/23 Antisense off-target ticrr
Chr3:109586458..109586480 19/23 Antisense off-target ticrr
Chr3:109586490..109586512 19/23 Antisense off-target ticrr
Chr3:109586522..109586544 19/23 Antisense off-target ticrr
Chr3:109586554..109586576 19/23 Antisense off-target ticrr
Chr3:109586586..109586608 19/23 Antisense off-target ticrr
Chr3:109586617..109586639 19/23 Antisense off-target ticrr
Chr3:109586648..109586670 19/23 Antisense off-target ticrr
Chr3:140607176..140607198 19/23 Antisense off-target nacc1
Chr3:140607259..140607281 19/23 Antisense off-target nacc1
Chr3:67487872..67487894 19/23 Antisense off-target mdfic
Chr3:81756143..81756165 19/23 Antisense off-target bend7
Chr3:81756177..81756199 19/23 Antisense off-target bend7
Chr3:81756211..81756233 19/23 Antisense off-target bend7
Chr4:101120329..101120351 19/23 Antisense off-target qsox1
Chr4:101120363..101120385 19/23 Antisense off-target qsox1
Chr4:74925540..74925562 19/23 Antisense off-target aars1
Chr4:74926295..74926317 19/23 Antisense off-target aars1
Chr4:74926361..74926383 19/23 Antisense off-target aars1
Chr4:74926396..74926418 19/23 Antisense off-target aars1
Chr4:74926584..74926606 19/23 Antisense off-target aars1
Chr4:74926618..74926640 19/23 Antisense off-target aars1
Chr4:74926652..74926674 19/23 Antisense off-target aars1
Chr4:74926852..74926874 19/23 Antisense off-target aars1
Chr4:74925573..74925595 19/23 Antisense off-target aars1
Chr4:74926010..74926032 19/23 Antisense off-target aars1
Chr5:114630447..114630469 19/23 Sense off-target ppm1l
Chr5:40496760..40496782 19/23 Sense off-target nphp1
Chr5:40496828..40496850 19/23 Sense off-target nphp1
Chr5:40496861..40496883 19/23 Sense off-target nphp1
Chr5:8745036..8745058 19/23 Antisense off-target wdr26
Chr5:8745085..8745107 19/23 Antisense off-target wdr26
Chr5:8745118..8745140 19/23 Antisense off-target wdr26
Chr5:8745202..8745224 19/23 Antisense off-target wdr26
Chr5:8745335..8745357 19/23 Antisense off-target wdr26
Chr5:8745367..8745389 19/23 Antisense off-target wdr26
Chr5:8745400..8745422 19/23 Antisense off-target wdr26
Chr5:8745433..8745455 19/23 Antisense off-target wdr26
Chr5:8745516..8745538 19/23 Antisense off-target wdr26
Chr5:8745598..8745620 19/23 Antisense off-target wdr26
Chr5:48675499..48675521 19/23 Sense off-target syne1
Chr5:48675675..48675697 19/23 Sense off-target syne1
Chr5:48675709..48675731 19/23 Sense off-target syne1
Chr5:8744970..8744992 19/23 Antisense off-target wdr26
Chr5:8745003..8745025 19/23 Antisense off-target wdr26
Chr5:8745648..8745670 19/23 Antisense off-target wdr26
Chr5:8745713..8745735 19/23 Antisense off-target wdr26
Chr6:152511457..152511479 19/23 Sense off-target tsta3
Chr6:61732192..61732214 19/23 Sense off-target pde1c
Chr6:61732852..61732874 19/23 Sense off-target pde1c
Chr7:33150126..33150148 19/23 Antisense off-target hoga1
Chr8:101287315..101287337 19/23 Antisense off-target syne2
Chr8:101287416..101287438 19/23 Antisense off-target syne2
Chr8:26110696..26110718 19/23 Antisense off-target kdm5c
Chr8:87919929..87919951 19/23 Sense off-target unc79
Chr8:87920025..87920047 19/23 Sense off-target unc79
Chr9:25305867..25305889 19/23 Antisense off-target usp42
Chr9:43172927..43172949 19/23 Antisense off-target wipi2
Chr9:43172961..43172983 19/23 Antisense off-target wipi2
Chr9:43173047..43173069 19/23 Antisense off-target wipi2
Chr9:68161978..68162000 19/23 Sense off-target myo3b
Chr9:68162045..68162067 19/23 Sense off-target myo3b
Chr9:68162221..68162243 19/23 Sense off-target myo3b
Chr9:68162301..68162323 19/23 Sense off-target myo3b
Chr9:69046482..69046504 19/23 Antisense off-target cers6
Chr9:72873859..72873881 19/23 Sense off-target itgb6
Chr9:72873907..72873929 19/23 Sense off-target itgb6
Chr9:72874178..72874200 19/23 Sense off-target itgb6
Chr9:72892381..72892403 19/23 Antisense off-target itgb6
Chr9:72892481..72892503 19/23 Antisense off-target itgb6
Chr9:72892561..72892583 19/23 Antisense off-target itgb6
Chr9:68161789..68161811 19/23 Sense off-target myo3b
Chr9:68161892..68161914 19/23 Sense off-target myo3b
Chr1:136295377..136295399 19/23 Antisense off-target cdc14b
Chr1:136295445..136295467 19/23 Antisense off-target cdc14b
Chr1:136295479..136295501 19/23 Antisense off-target cdc14b
Chr2:116322787..116322809 19/23 Sense off-target atp11a
Chr2:116322855..116322877 19/23 Sense off-target atp11a
Chr2:116322955..116322977 19/23 Sense off-target atp11a
Chr2:116322989..116323011 19/23 Sense off-target atp11a
Chr2:116323023..116323045 19/23 Sense off-target atp11a
Chr2:116323090..116323112 19/23 Sense off-target atp11a
Chr2:116322753..116322775 19/23 Sense off-target atp11a
Chr2:168783453..168783475 19/23 Antisense off-target ccdc81
Chr2:168783487..168783509 19/23 Antisense off-target ccdc81
Chr2:168783266..168783288 19/23 Antisense off-target ccdc81
Chr2:168783419..168783441 19/23 Antisense off-target ccdc81
Chr2:168783555..168783577 19/23 Antisense off-target ccdc81
Chr2:168783621..168783643 19/23 Antisense off-target ccdc81
Chr3:140915152..140915174 19/23 Antisense off-target alkbh7
Chr3:140915202..140915224 19/23 Antisense off-target alkbh7
Chr3:140915366..140915388 19/23 Antisense off-target alkbh7
Chr3:140915415..140915437 19/23 Antisense off-target alkbh7
Chr4:44344254..44344276 19/23 Sense off-target znf423
Chr4:48157191..48157213 19/23 Sense off-target necab2
Chr5:15029758..15029780 19/23 Sense off-target bicral
Chr6:44745495..44745517 19/23 Antisense off-target tbc1d5
Chr6:44745704..44745726 19/23 Antisense off-target tbc1d5
Chr6:28233454..28233476 19/23 Sense off-target cacnb2
Chr6:28233682..28233704 19/23 Sense off-target cacnb2
Chr6:31700946..31700968 19/23 Sense off-target ankib1
Chr6:92441277..92441299 19/23 Sense off-target jarid2
Chr6:92441311..92441333 19/23 Sense off-target jarid2
Chr7:31313884..31313906 19/23 Sense off-target kcnip2
Chr8:79472274..79472296 19/23 Sense off-target tmem91
Chr8:79472308..79472330 19/23 Sense off-target tmem91
Chr8:79472371..79472393 19/23 Sense off-target tmem91
Chr1:151356238..151356260 19/23 Sense off-target tmem233
Chr1:151356290..151356312 19/23 Sense off-target tmem233
Chr2:158392122..158392144 19/23 Sense off-target parp4.1
Chr2:158392225..158392247 19/23 Sense off-target parp4.1
Chr2:42867186..42867208 19/23 Antisense off-target tspoap1
Chr2:42867232..42867254 19/23 Antisense off-target tspoap1
Chr2:42867266..42867288 19/23 Antisense off-target tspoap1
Chr2:66978900..66978922 19/23 Antisense off-target pik3c2b
Chr3:111954224..111954246 19/23 Sense off-target slco3a1
Chr3:111954292..111954314 19/23 Sense off-target slco3a1
Chr3:111954388..111954410 19/23 Sense off-target slco3a1
Chr3:111954485..111954507 19/23 Sense off-target slco3a1
Chr3:7580445..7580467 19/23 Antisense off-target akr1c8p
Chr3:7580479..7580501 19/23 Antisense off-target akr1c8p
Chr3:8942520..8942542 19/23 Sense off-target cacna1c
Chr3:8942585..8942607 19/23 Sense off-target cacna1c
Chr5:100010719..100010741 19/23 Antisense off-target ccdc150
Chr5:100010789..100010811 19/23 Antisense off-target ccdc150
Chr5:61809602..61809624 19/23 Antisense off-target arfgef3
Chr6:61425163..61425185 19/23 Sense off-target itprid1
Chr6:61425242..61425264 19/23 Sense off-target itprid1
Chr6:71617231..71617253 19/23 Sense off-target msantd3
Chr1:14429876..14429898 19/23 Sense off-target atp6v1b1
Chr1:14429909..14429931 19/23 Sense off-target atp6v1b1
Chr1:14430040..14430062 19/23 Sense off-target atp6v1b1
Chr1:14430073..14430095 19/23 Sense off-target atp6v1b1
Chr1:14430106..14430128 19/23 Sense off-target atp6v1b1
Chr1:14430156..14430178 19/23 Sense off-target atp6v1b1
Chr1:14430190..14430212 19/23 Sense off-target atp6v1b1
Chr1:14430240..14430262 19/23 Sense off-target atp6v1b1
Chr1:14430357..14430379 19/23 Sense off-target atp6v1b1
Chr1:14430405..14430427 19/23 Sense off-target atp6v1b1
Chr1:14430518..14430540 19/23 Sense off-target atp6v1b1
Chr1:14430566..14430588 19/23 Sense off-target atp6v1b1
Chr1:14430274..14430296 19/23 Sense off-target atp6v1b1
Chr1:14430324..14430346 19/23 Sense off-target atp6v1b1
Chr1:179753573..179753595 19/23 Sense off-target tmem161b
Chr2:158038955..158038977 19/23 Sense off-target arhgap20
Chr2:158039023..158039045 19/23 Sense off-target arhgap20
Chr2:39772928..39772950 19/23 Sense off-target il1rapl1
Chr2:39773045..39773067 19/23 Sense off-target il1rapl1
Chr2:90332810..90332832 19/23 Sense off-target zbtb8a.1
Chr5:36687634..36687656 19/23 Sense off-target ralgapa2
Chr5:36687667..36687689 19/23 Sense off-target ralgapa2
Chr5:36687700..36687722 19/23 Sense off-target ralgapa2
Chr5:36687733..36687755 19/23 Sense off-target ralgapa2
Chr5:36687766..36687788 19/23 Sense off-target ralgapa2
Chr5:36687799..36687821 19/23 Sense off-target ralgapa2
Chr5:36687832..36687854 19/23 Sense off-target ralgapa2
Chr5:36687898..36687920 19/23 Sense off-target ralgapa2
Chr6:138088246..138088268 19/23 Sense off-target trpv4l.3
Chr6:69014525..69014547 19/23 Antisense off-target adamts16
Chr8:107900948..107900970 19/23 Sense off-target chst9l.1
Chr7:108874868..108874890 19/23 Antisense off-target ceacam19ly
Chr7:108874953..108874975 19/23 Antisense off-target ceacam19ly
Chr7:108875067..108875089 19/23 Antisense off-target ceacam19ly
Chr1:162536943..162536965 19/23 Sense off-target LOC108645387
Chr1:162537022..162537044 19/23 Sense off-target LOC108645387
Chr1:162537519..162537541 19/23 Antisense off-target LOC108645387
Chr1:198268783..198268805 19/23 Antisense off-target LOC100488176
Chr1:28774803..28774825 19/23 Antisense off-target LOC105946358
Chr1:28775056..28775078 19/23 Antisense off-target LOC105946358
Chr1:28775107..28775129 19/23 Antisense off-target LOC105946358
Chr1:527170..527192 19/23 Sense off-target LOC116408259
Chr1:527236..527258 19/23 Sense off-target LOC116408259
Chr1:527269..527291 19/23 Sense off-target LOC116408259
Chr1:527365..527387 19/23 Sense off-target LOC116408259
Chr1:527464..527486 19/23 Sense off-target LOC116408259
Chr1:527513..527535 19/23 Sense off-target LOC116408259
Chr1:28775201..28775223 19/23 Antisense off-target LOC105946358
Chr1:869553..869575 19/23 Sense off-target LOC116408329
Chr1:869633..869655 19/23 Sense off-target LOC116408329
Chr1:869680..869702 19/23 Sense off-target LOC116408329
Chr1:869829..869851 19/23 Sense off-target LOC116408329
Chr1:869863..869885 19/23 Sense off-target LOC116408329
Chr2:156415394..156415416 19/23 Sense off-target LOC101731007
Chr2:156415461..156415483 19/23 Sense off-target LOC101731007
Chr2:156415575..156415597 19/23 Sense off-target LOC101731007
Chr2:156415609..156415631 19/23 Sense off-target LOC101731007
Chr2:156415643..156415665 19/23 Sense off-target LOC101731007
Chr2:156415677..156415699 19/23 Sense off-target LOC101731007
Chr2:156415172..156415194 19/23 Sense off-target LOC101731007
Chr2:156415206..156415228 19/23 Sense off-target LOC101731007
Chr2:156415240..156415262 19/23 Sense off-target LOC101731007
Chr2:156415360..156415382 19/23 Sense off-target LOC101731007
Chr2:156415763..156415785 19/23 Sense off-target LOC101731007
Chr2:156415797..156415819 19/23 Sense off-target LOC101731007
Chr2:156415864..156415886 19/23 Sense off-target LOC101731007
Chr2:156415979..156416001 19/23 Sense off-target LOC101731007
Chr2:158392122..158392144 19/23 Sense off-target LOC101733406
Chr2:158392225..158392247 19/23 Sense off-target LOC101733406
Chr2:172199111..172199133 19/23 Antisense off-target LOC100489685
Chr2:172199179..172199201 19/23 Antisense off-target LOC100489685
Chr2:172199247..172199269 19/23 Antisense off-target LOC100489685
Chr2:172199344..172199366 19/23 Antisense off-target LOC100489685
Chr2:172199442..172199464 19/23 Antisense off-target LOC100489685
Chr3:138512772..138512794 19/23 Sense off-target LOC100380178
Chr3:141153379..141153401 19/23 Antisense off-target LOC100497605
Chr3:141153713..141153735 19/23 Antisense off-target LOC100497605
Chr3:36264021..36264043 19/23 Sense off-target LOC105946809
Chr3:36264021..36264043 19/23 Antisense off-target LOC116409712
Chr3:54777634..54777656 19/23 Sense off-target LOC100486632
Chr3:54777803..54777825 19/23 Sense off-target LOC100486632
Chr3:54777918..54777940 19/23 Sense off-target LOC100486632
Chr3:54777982..54778004 19/23 Sense off-target LOC100486632
Chr3:7580445..7580467 19/23 Antisense off-target LOC116409681
Chr3:54777668..54777690 19/23 Sense off-target LOC100486632
Chr3:7580479..7580501 19/23 Antisense off-target LOC116409681
Chr4:12467115..12467137 19/23 Antisense off-target LOC105946102
Chr4:12467178..12467200 19/23 Antisense off-target LOC105946102
Chr4:12467312..12467334 19/23 Antisense off-target LOC105946102
Chr4:28445129..28445151 19/23 Antisense off-target LOC101734651
Chr4:28445268..28445290 19/23 Antisense off-target LOC101734651
Chr4:28445301..28445323 19/23 Antisense off-target LOC101734651
Chr4:28445411..28445433 19/23 Antisense off-target LOC101734651
Chr4:28445445..28445467 19/23 Antisense off-target LOC101734651
Chr4:28445510..28445532 19/23 Antisense off-target LOC101734651
Chr4:28445543..28445565 19/23 Antisense off-target LOC101734651
Chr4:28445576..28445598 19/23 Antisense off-target LOC101734651
Chr4:28445709..28445731 19/23 Antisense off-target LOC101734651
Chr4:28445757..28445779 19/23 Antisense off-target LOC101734651
Chr4:28445808..28445830 19/23 Antisense off-target LOC101734651
Chr7:126530773..126530795 19/23 Antisense off-target LOC101734343
Chr7:126530889..126530911 19/23 Antisense off-target LOC101734343
Chr7:126531004..126531026 19/23 Antisense off-target LOC101734343
Chr7:128060423..128060445 19/23 Sense off-target LOC116412020
Chr8:122720815..122720837 19/23 Antisense off-target LOC101733428
Chr8:122720864..122720886 19/23 Antisense off-target LOC101733428
Chr8:122720959..122720981 19/23 Antisense off-target LOC101733428
Chr8:122720991..122721013 19/23 Antisense off-target LOC101733428
Chr8:136352882..136352904 19/23 Antisense off-target LOC105945582
Chr8:140426450..140426472 19/23 Sense off-target LOC108648274
Chr8:140426483..140426505 19/23 Sense off-target LOC108648274
Chr8:140426614..140426636 19/23 Sense off-target LOC108648274
Chr8:140426647..140426669 19/23 Sense off-target LOC108648274
Chr8:140426759..140426781 19/23 Sense off-target LOC108648274
Chr8:140426838..140426860 19/23 Sense off-target LOC108648274
Chr8:140426902..140426924 19/23 Sense off-target LOC108648274
Chr8:140426951..140426973 19/23 Sense off-target LOC108648274
Chr8:140426985..140427007 19/23 Sense off-target LOC108648274
Chr8:140427017..140427039 19/23 Sense off-target LOC108648274
Chr8:140427065..140427087 19/23 Sense off-target LOC108648274
Chr8:140427144..140427166 19/23 Sense off-target LOC108648274
Chr8:140427223..140427245 19/23 Sense off-target LOC108648274
Chr8:5040073..5040095 19/23 Sense off-target LOC100145503
Chr8:5040073..5040095 19/23 Sense off-target LOC101733314
Chr8:5040182..5040204 19/23 Sense off-target LOC100145503
Chr8:5040182..5040204 19/23 Sense off-target LOC101733314
Chr8:5040463..5040485 19/23 Sense off-target LOC100145503
Chr8:5040463..5040485 19/23 Sense off-target LOC101733314
Chr8:5040528..5040550 19/23 Sense off-target LOC100145503
Chr8:5040528..5040550 19/23 Sense off-target LOC101733314
Chr8:5040698..5040720 19/23 Sense off-target LOC100145503
Chr8:5040698..5040720 19/23 Sense off-target LOC101733314
Chr9:1537443..1537465 19/23 Sense off-target LOC101732019
Chr9:1537618..1537640 19/23 Sense off-target LOC101732019
Chr9:66471062..66471084 19/23 Sense off-target LOC101732302
Chr9:66471095..66471117 19/23 Sense off-target LOC101732302
Chr9:66471128..66471150 19/23 Sense off-target LOC101732302
Chr9:66471177..66471199 19/23 Sense off-target LOC101732302
Chr9:66471245..66471267 19/23 Sense off-target LOC101732302
Chr9:66471280..66471302 19/23 Sense off-target LOC101732302
Chr9:66471384..66471406 19/23 Sense off-target LOC101732302
Chr9:66471420..66471442 19/23 Sense off-target LOC101732302
Chr9:66471455..66471477 19/23 Sense off-target LOC101732302
Chr9:66471490..66471512 19/23 Sense off-target LOC101732302
Chr9:66471524..66471546 19/23 Sense off-target LOC101732302
Chr9:66471558..66471580 19/23 Sense off-target LOC101732302
Chr9:66471592..66471614 19/23 Sense off-target LOC101732302
Chr9:66471659..66471681 19/23 Sense off-target LOC101732302
Chr9:66471693..66471715 19/23 Sense off-target LOC101732302
Chr9:66471729..66471751 19/23 Sense off-target LOC101732302
Chr9:66471764..66471786 19/23 Sense off-target LOC101732302
Chr9:66471799..66471821 19/23 Sense off-target LOC101732302
Chr9:66471833..66471855 19/23 Sense off-target LOC101732302
Chr9:66471867..66471889 19/23 Sense off-target LOC101732302
Chr9:66471901..66471923 19/23 Sense off-target LOC101732302
Chr9:66471935..66471957 19/23 Sense off-target LOC101732302
Chr9:66471969..66471991 19/23 Sense off-target LOC101732302
Chr9:66471315..66471337 19/23 Sense off-target LOC101732302
Chr9:66471350..66471372 19/23 Sense off-target LOC101732302
Chr9:66472019..66472041 19/23 Sense off-target LOC101732302
Chr1:111028037..111028059 20/23 unknown
Chr1:129676839..129676861 20/23 unknown
Chr1:172121645..172121667 20/23 unknown
Chr1:191110981..191111003 20/23 unknown
Chr1:211468217..211468239 20/23 unknown
Chr1:211468235..211468257 20/23 unknown
Chr1:211468253..211468275 20/23 unknown
Chr1:211468408..211468430 20/23 unknown
Chr1:21518271..21518293 20/23 unknown
Chr1:21518341..21518363 20/23 unknown
Chr1:21518394..21518416 20/23 unknown
Chr1:21518483..21518505 20/23 unknown
Chr1:21518518..21518540 20/23 unknown
Chr1:212398349..212398371 20/23 unknown
Chr1:4134050..4134072 20/23 unknown
Chr10:40469233..40469255 20/23 unknown
Chr1:94295430..94295452 20/23 unknown
Chr10:49863195..49863217 20/23 unknown
Chr10:49863263..49863285 20/23 unknown
Chr2:11600516..11600538 20/23 unknown
Chr2:11600621..11600643 20/23 unknown
Chr2:11600639..11600661 20/23 unknown
Chr2:11600657..11600679 20/23 unknown
Chr2:142527205..142527227 20/23 unknown
Chr2:171968770..171968792 20/23 unknown
Chr2:94694768..94694790 20/23 unknown
Chr3:130873556..130873578 20/23 unknown
Chr3:130873772..130873794 20/23 unknown
Chr3:68032052..68032074 20/23 unknown
Chr3:68032070..68032092 20/23 unknown
Chr3:68032088..68032110 20/23 unknown
Chr3:91501287..91501309 20/23 unknown
Chr3:99170859..99170881 20/23 unknown
Chr3:99170877..99170899 20/23 unknown
Chr3:99376276..99376298 20/23 unknown
Chr4:127077060..127077082 20/23 unknown
Chr4:122519840..122519862 20/23 unknown
Chr4:26150330..26150352 20/23 unknown
Chr4:26150417..26150439 20/23 unknown
Chr4:26150501..26150523 20/23 unknown
Chr4:27800720..27800742 20/23 unknown
Chr4:59694962..59694984 20/23 unknown
Chr5:261288..261310 20/23 unknown
Chr5:261357..261379 20/23 unknown
Chr5:261445..261467 20/23 unknown
Chr5:261481..261503 20/23 unknown
Chr5:261736..261758 20/23 unknown
Chr5:43618518..43618540 20/23 unknown
Chr5:998684..998706 20/23 unknown
Chr6:132704000..132704022 20/23 unknown
Chr6:132704018..132704040 20/23 unknown
Chr6:132704104..132704126 20/23 unknown
Chr7:108077741..108077763 20/23 unknown
Chr7:114974671..114974693 20/23 unknown
Chr7:5071437..5071459 20/23 unknown
Chr7:51384261..51384283 20/23 unknown
Chr7:51384279..51384301 20/23 unknown
Chr7:40453470..40453492 20/23 unknown
Chr7:51384417..51384439 20/23 unknown
Chr7:51385806..51385828 20/23 unknown
Chr7:51385825..51385847 20/23 unknown
Chr7:51385912..51385934 20/23 unknown
Chr7:51385930..51385952 20/23 unknown
Chr7:51385948..51385970 20/23 unknown
Chr8:123326352..123326374 20/23 unknown
Chr8:131178090..131178112 20/23 unknown
Chr8:134673081..134673103 20/23 unknown
Chr8:138463558..138463580 20/23 unknown
Chr8:9969754..9969776 20/23 unknown
Chr9:34440776..34440798 20/23 unknown
Chr9:34440844..34440866 20/23 unknown
Chr9:89053436..89053458 20/23 unknown
Chr1:100922354..100922376 19/23 unknown
Chr1:100922404..100922426 19/23 unknown
Chr1:100922506..100922528 19/23 unknown
Chr1:100922603..100922625 19/23 unknown
Chr1:100922637..100922659 19/23 unknown
Chr1:100922846..100922868 19/23 unknown
Chr1:106978536..106978558 19/23 unknown
Chr1:111028105..111028127 19/23 unknown
Chr1:111028202..111028224 19/23 unknown
Chr1:112839458..112839480 19/23 unknown
Chr1:126388856..126388878 19/23 unknown
Chr1:126388919..126388941 19/23 unknown
Chr1:126388981..126389003 19/23 unknown
Chr1:129676906..129676928 19/23 unknown
Chr1:100922798..100922820 19/23 unknown
Chr1:136221837..136221859 19/23 unknown
Chr1:142732486..142732508 19/23 unknown
Chr1:142732553..142732575 19/23 unknown
Chr1:129934727..129934749 19/23 unknown
Chr1:163606441..163606463 19/23 unknown
Chr1:163606475..163606497 19/23 unknown
Chr1:163606525..163606547 19/23 unknown
Chr1:163606559..163606581 19/23 unknown
Chr1:163606592..163606614 19/23 unknown
Chr1:163606659..163606681 19/23 unknown
Chr1:163606737..163606759 19/23 unknown
Chr1:163606771..163606793 19/23 unknown
Chr1:163606821..163606843 19/23 unknown
Chr1:163606855..163606877 19/23 unknown
Chr1:163606995..163607017 19/23 unknown
Chr1:163607044..163607066 19/23 unknown
Chr1:175631734..175631756 19/23 unknown
Chr1:18020451..18020473 19/23 unknown
Chr1:18020519..18020541 19/23 unknown
Chr1:184292915..184292937 19/23 unknown
Chr1:196682330..196682352 19/23 unknown
Chr1:196682376..196682398 19/23 unknown
Chr1:196682455..196682477 19/23 unknown
Chr1:196682539..196682561 19/23 unknown
Chr1:196682617..196682639 19/23 unknown
Chr1:198290924..198290946 19/23 unknown
Chr1:198291018..198291040 19/23 unknown
Chr1:206205443..206205465 19/23 unknown
Chr1:206205502..206205524 19/23 unknown
Chr1:207172160..207172182 19/23 unknown
Chr1:207172208..207172230 19/23 unknown
Chr1:207172434..207172456 19/23 unknown
Chr1:207172550..207172572 19/23 unknown
Chr1:207172666..207172688 19/23 unknown
Chr1:207172732..207172754 19/23 unknown
Chr1:211324283..211324305 19/23 unknown
Chr1:211918729..211918751 19/23 unknown
Chr1:211918779..211918801 19/23 unknown
Chr1:211918859..211918881 19/23 unknown
Chr1:211918941..211918963 19/23 unknown
Chr1:211919055..211919077 19/23 unknown
Chr1:214303522..214303544 19/23 unknown
Chr1:21955144..21955166 19/23 unknown
Chr1:21955194..21955216 19/23 unknown
Chr1:21955324..21955346 19/23 unknown
Chr1:28142171..28142193 19/23 unknown
Chr1:28142219..28142241 19/23 unknown
Chr1:28346094..28346116 19/23 unknown
Chr1:28346193..28346215 19/23 unknown
Chr1:214302874..214302896 19/23 unknown
Chr1:43436295..43436317 19/23 unknown
Chr1:43436345..43436367 19/23 unknown
Chr1:43436395..43436417 19/23 unknown
Chr1:43436594..43436616 19/23 unknown
Chr1:4531791..4531813 19/23 unknown
Chr1:51378360..51378382 19/23 unknown
Chr1:68433824..68433846 19/23 unknown
Chr1:71752076..71752098 19/23 unknown
Chr1:71752109..71752131 19/23 unknown
Chr1:94295179..94295201 19/23 unknown
Chr1:94295229..94295251 19/23 unknown
Chr1:94295299..94295321 19/23 unknown
Chr1:94295398..94295420 19/23 unknown
Chr10:4658910..4658932 19/23 unknown
Chr10:4658944..4658966 19/23 unknown
Chr10:4659094..4659116 19/23 unknown
Chr1:96339058..96339080 19/23 unknown
Chr10:29752252..29752274 19/23 unknown
Chr10:31997147..31997169 19/23 unknown
Chr10:31997179..31997201 19/23 unknown
Chr10:31997292..31997314 19/23 unknown
Chr10:36016513..36016535 19/23 unknown
Chr2:114725699..114725721 19/23 unknown
Chr2:114725813..114725835 19/23 unknown
Chr2:114725847..114725869 19/23 unknown
Chr2:114725881..114725903 19/23 unknown
Chr2:114725915..114725937 19/23 unknown
Chr10:6885144..6885166 19/23 unknown
Chr10:6885207..6885229 19/23 unknown
Chr10:6885382..6885404 19/23 unknown
Chr2:106772614..106772636 19/23 unknown
Chr2:106772646..106772668 19/23 unknown
Chr2:109440058..109440080 19/23 unknown
Chr2:109440091..109440113 19/23 unknown
Chr2:109440124..109440146 19/23 unknown
Chr2:109440157..109440179 19/23 unknown
Chr2:109440190..109440212 19/23 unknown
Chr2:109440273..109440295 19/23 unknown
Chr2:109440402..109440424 19/23 unknown
Chr2:11600374..11600396 19/23 unknown
Chr2:11600498..11600520 19/23 unknown
Chr2:135341918..135341940 19/23 unknown
Chr2:135341966..135341988 19/23 unknown
Chr2:149010274..149010296 19/23 unknown
Chr2:149010323..149010345 19/23 unknown
Chr2:150413832..150413854 19/23 unknown
Chr2:151728518..151728540 19/23 unknown
Chr2:151728647..151728669 19/23 unknown
Chr2:143268048..143268070 19/23 unknown
Chr2:148432791..148432813 19/23 unknown
Chr2:148432967..148432989 19/23 unknown
Chr2:149009920..149009942 19/23 unknown
Chr2:149009970..149009992 19/23 unknown
Chr2:149010019..149010041 19/23 unknown
Chr2:149010085..149010107 19/23 unknown
Chr2:149010148..149010170 19/23 unknown
Chr2:152664200..152664222 19/23 unknown
Chr2:152664287..152664309 19/23 unknown
Chr2:152664382..152664404 19/23 unknown
Chr2:152664416..152664438 19/23 unknown
Chr2:152664541..152664563 19/23 unknown
Chr2:153447794..153447816 19/23 unknown
Chr2:153447873..153447895 19/23 unknown
Chr2:153447937..153447959 19/23 unknown
Chr2:157397906..157397928 19/23 unknown
Chr2:157397991..157398013 19/23 unknown
Chr2:32074363..32074385 19/23 unknown
Chr2:32074456..32074478 19/23 unknown
Chr2:27574976..27574998 19/23 unknown
Chr2:27575024..27575046 19/23 unknown
Chr2:27575054..27575076 19/23 unknown
Chr2:27575118..27575140 19/23 unknown
Chr2:27575309..27575331 19/23 unknown
Chr2:27575342..27575364 19/23 unknown
Chr2:32074269..32074291 19/23 unknown
Chr2:41635711..41635733 19/23 unknown
Chr2:41635791..41635813 19/23 unknown
Chr2:41635919..41635941 19/23 unknown
Chr2:41636004..41636026 19/23 unknown
Chr2:41636054..41636076 19/23 unknown
Chr2:52285904..52285926 19/23 unknown
Chr2:54046971..54046993 19/23 unknown
Chr2:54047048..54047070 19/23 unknown
Chr2:54047127..54047149 19/23 unknown
Chr2:54048580..54048602 19/23 unknown
Chr2:54048657..54048679 19/23 unknown
Chr2:54048736..54048758 19/23 unknown
Chr2:89224953..89224975 19/23 unknown
Chr2:64545138..64545160 19/23 unknown
Chr2:64545204..64545226 19/23 unknown
Chr2:67166788..67166810 19/23 unknown
Chr2:67166938..67166960 19/23 unknown
Chr2:7437189..7437211 19/23 unknown
Chr2:7437223..7437245 19/23 unknown
Chr2:7437257..7437279 19/23 unknown
Chr2:7437291..7437313 19/23 unknown
Chr2:77968808..77968830 19/23 unknown
Chr2:77968895..77968917 19/23 unknown
Chr2:77968961..77968983 19/23 unknown
Chr2:80429777..80429799 19/23 unknown
Chr2:80429875..80429897 19/23 unknown
Chr2:80430009..80430031 19/23 unknown
Chr2:89224920..89224942 19/23 unknown
Chr3:102628979..102629001 19/23 unknown
Chr3:104765665..104765687 19/23 unknown
Chr3:104765812..104765834 19/23 unknown
Chr3:104765990..104766012 19/23 unknown
Chr3:107586746..107586768 19/23 unknown
Chr3:116169624..116169646 19/23 unknown
Chr3:116169675..116169697 19/23 unknown
Chr3:123305686..123305708 19/23 unknown
Chr3:140050318..140050340 19/23 unknown
Chr3:140606878..140606900 19/23 unknown
Chr3:140606912..140606934 19/23 unknown
Chr3:140607060..140607082 19/23 unknown
Chr3:140606946..140606968 19/23 unknown
Chr3:143598560..143598582 19/23 unknown
Chr3:143598657..143598679 19/23 unknown
Chr3:143598706..143598728 19/23 unknown
Chr3:143598770..143598792 19/23 unknown
Chr3:143598917..143598939 19/23 unknown
Chr3:143598981..143599003 19/23 unknown
Chr3:147712634..147712656 19/23 unknown
Chr3:147712733..147712755 19/23 unknown
Chr3:147713726..147713748 19/23 unknown
Chr3:151973302..151973324 19/23 unknown
Chr3:152167563..152167585 19/23 unknown
Chr3:16927677..16927699 19/23 unknown
Chr3:16927755..16927777 19/23 unknown
Chr3:26768865..26768887 19/23 unknown
Chr3:26768899..26768921 19/23 unknown
Chr3:26769001..26769023 19/23 unknown
Chr3:26769100..26769122 19/23 unknown
Chr3:26769134..26769156 19/23 unknown
Chr3:26769168..26769190 19/23 unknown
Chr3:26769238..26769260 19/23 unknown
Chr3:28715744..28715766 19/23 unknown
Chr3:29323505..29323527 19/23 unknown
Chr3:29323668..29323690 19/23 unknown
Chr3:35767662..35767684 19/23 unknown
Chr3:35767728..35767750 19/23 unknown
Chr3:143599016..143599038 19/23 unknown
Chr3:35767945..35767967 19/23 unknown
Chr3:35768030..35768052 19/23 unknown
Chr3:3581800..3581822 19/23 unknown
Chr3:35952781..35952803 19/23 unknown
Chr3:35952829..35952851 19/23 unknown
Chr3:35952989..35953011 19/23 unknown
Chr3:35953071..35953093 19/23 unknown
Chr3:35953215..35953237 19/23 unknown
Chr3:35953332..35953354 19/23 unknown
Chr3:35953382..35953404 19/23 unknown
Chr3:35953479..35953501 19/23 unknown
Chr3:35953607..35953629 19/23 unknown
Chr3:35953706..35953728 19/23 unknown
Chr3:35953773..35953795 19/23 unknown
Chr3:37206540..37206562 19/23 unknown
Chr3:37206624..37206646 19/23 unknown
Chr3:35767843..35767865 19/23 unknown
Chr3:68107550..68107572 19/23 unknown
Chr3:68107583..68107605 19/23 unknown
Chr3:68107663..68107685 19/23 unknown
Chr3:70541095..70541117 19/23 unknown
Chr3:70541128..70541150 19/23 unknown
Chr3:70541193..70541215 19/23 unknown
Chr3:70541262..70541284 19/23 unknown
Chr3:70541350..70541372 19/23 unknown
Chr3:70541384..70541406 19/23 unknown
Chr3:70541480..70541502 19/23 unknown
Chr3:81181213..81181235 19/23 unknown
Chr3:81181293..81181315 19/23 unknown
Chr3:81181421..81181443 19/23 unknown
Chr3:91500968..91500990 19/23 unknown
Chr3:91501115..91501137 19/23 unknown
Chr3:91501167..91501189 19/23 unknown
Chr3:91501236..91501258 19/23 unknown
Chr3:91501402..91501424 19/23 unknown
Chr3:91501453..91501475 19/23 unknown
Chr3:91501503..91501525 19/23 unknown
Chr3:91609677..91609699 19/23 unknown
Chr3:91609726..91609748 19/23 unknown
Chr3:99170667..99170689 19/23 unknown
Chr3:99376257..99376279 19/23 unknown
Chr3:99376347..99376369 19/23 unknown
Chr4:112748322..112748344 19/23 unknown
Chr4:112748356..112748378 19/23 unknown
Chr4:118765505..118765527 19/23 unknown
Chr4:118765567..118765589 19/23 unknown
Chr4:118765663..118765685 19/23 unknown
Chr4:12118274..12118296 19/23 unknown
Chr4:12118322..12118344 19/23 unknown
Chr4:12118355..12118377 19/23 unknown
Chr4:12118454..12118476 19/23 unknown
Chr4:12118488..12118510 19/23 unknown
Chr3:91609793..91609815 19/23 unknown
Chr4:122520630..122520652 19/23 unknown
Chr4:12297693..12297715 19/23 unknown
Chr4:12297726..12297748 19/23 unknown
Chr4:12297863..12297885 19/23 unknown
Chr4:12297897..12297919 19/23 unknown
Chr4:128818415..128818437 19/23 unknown
Chr4:134423717..134423739 19/23 unknown
Chr4:134423768..134423790 19/23 unknown
Chr4:20512704..20512726 19/23 unknown
Chr4:26150641..26150663 19/23 unknown
Chr4:27800672..27800694 19/23 unknown
Chr4:36262518..36262540 19/23 unknown
Chr4:45382866..45382888 19/23 unknown
Chr4:47251978..47252000 19/23 unknown
Chr4:26150537..26150559 19/23 unknown
Chr4:48025159..48025181 19/23 unknown
Chr4:48025206..48025228 19/23 unknown
Chr4:48025240..48025262 19/23 unknown
Chr4:48025448..48025470 19/23 unknown
Chr4:48025496..48025518 19/23 unknown
Chr4:51822713..51822735 19/23 unknown
Chr4:51822730..51822752 19/23 unknown
Chr4:51822747..51822769 19/23 unknown
Chr4:63002998..63003020 19/23 unknown
Chr4:67234483..67234505 19/23 unknown
Chr4:67279188..67279210 19/23 unknown
Chr4:73905183..73905205 19/23 unknown
Chr4:73905215..73905237 19/23 unknown
Chr4:47252045..47252067 19/23 unknown
Chr4:47252078..47252100 19/23 unknown
Chr5:100242824..100242846 19/23 unknown
Chr5:104551248..104551270 19/23 unknown
Chr5:104551314..104551336 19/23 unknown
Chr5:104551348..104551370 19/23 unknown
Chr5:104551382..104551404 19/23 unknown
Chr5:104551434..104551456 19/23 unknown
Chr5:104551468..104551490 19/23 unknown
Chr5:108526504..108526526 19/23 unknown
Chr5:108526571..108526593 19/23 unknown
Chr5:115329086..115329108 19/23 unknown
Chr5:115329154..115329176 19/23 unknown
Chr5:115329268..115329290 19/23 unknown
Chr5:140675824..140675846 19/23 unknown
Chr5:140675924..140675946 19/23 unknown
Chr5:147432189..147432211 19/23 unknown
Chr5:147438858..147438880 19/23 unknown
Chr5:147438906..147438928 19/23 unknown
Chr5:147438972..147438994 19/23 unknown
Chr5:154267808..154267830 19/23 unknown
Chr5:154267892..154267914 19/23 unknown
Chr5:154267942..154267964 19/23 unknown
Chr5:154268055..154268077 19/23 unknown
Chr5:115329052..115329074 19/23 unknown
Chr5:156579768..156579790 19/23 unknown
Chr5:156579820..156579842 19/23 unknown
Chr5:156579887..156579909 19/23 unknown
Chr5:156579955..156579977 19/23 unknown
Chr5:156580005..156580027 19/23 unknown
Chr5:24758950..24758972 19/23 unknown
Chr5:24758998..24759020 19/23 unknown
Chr5:24759048..24759070 19/23 unknown
Chr5:24759098..24759120 19/23 unknown
Chr5:261517..261539 19/23 unknown
Chr5:261584..261606 19/23 unknown
Chr5:156579632..156579654 19/23 unknown
Chr5:156579700..156579722 19/23 unknown
Chr5:26198263..26198285 19/23 unknown
Chr5:26198312..26198334 19/23 unknown
Chr5:27061633..27061655 19/23 unknown
Chr5:261617..261639 19/23 unknown
Chr5:26198230..26198252 19/23 unknown
Chr5:43618450..43618472 19/23 unknown
Chr5:47425957..47425979 19/23 unknown
Chr5:56274704..56274726 19/23 unknown
Chr5:56274754..56274776 19/23 unknown
Chr5:56274898..56274920 19/23 unknown
Chr5:93096493..93096515 19/23 unknown
Chr5:93096525..93096547 19/23 unknown
Chr5:95317054..95317076 19/23 unknown
Chr5:95317138..95317160 19/23 unknown
Chr5:97257663..97257685 19/23 unknown
Chr5:998462..998484 19/23 unknown
Chr5:998494..998516 19/23 unknown
Chr6:103865136..103865158 19/23 unknown
Chr5:89198242..89198264 19/23 unknown
Chr5:89198274..89198296 19/23 unknown
Chr5:93096430..93096452 19/23 unknown
Chr6:127867205..127867227 19/23 unknown
Chr6:127867255..127867277 19/23 unknown
Chr6:127867390..127867412 19/23 unknown
Chr6:127867474..127867496 19/23 unknown
Chr6:127867579..127867601 19/23 unknown
Chr6:127867848..127867870 19/23 unknown
Chr6:127869079..127869101 19/23 unknown
Chr6:127869129..127869151 19/23 unknown
Chr6:127869264..127869286 19/23 unknown
Chr6:127869348..127869370 19/23 unknown
Chr6:103865186..103865208 19/23 unknown
Chr6:103865511..103865533 19/23 unknown
Chr6:103865560..103865582 19/23 unknown
Chr6:105043999..105044021 19/23 unknown
Chr6:105044033..105044055 19/23 unknown
Chr6:105044066..105044088 19/23 unknown
Chr6:123441122..123441144 19/23 unknown
Chr6:123441206..123441228 19/23 unknown
Chr6:123441255..123441277 19/23 unknown
Chr6:149606509..149606531 19/23 unknown
Chr6:20768911..20768933 19/23 unknown
Chr6:25427382..25427404 19/23 unknown
Chr6:25427462..25427484 19/23 unknown
Chr6:127869453..127869475 19/23 unknown
Chr6:127869740..127869762 19/23 unknown
Chr6:129519313..129519335 19/23 unknown
Chr6:129519346..129519368 19/23 unknown
Chr6:129519481..129519503 19/23 unknown
Chr6:129519515..129519537 19/23 unknown
Chr6:130056623..130056645 19/23 unknown
Chr6:130056688..130056710 19/23 unknown
Chr6:130056786..130056808 19/23 unknown
Chr6:132703893..132703915 19/23 unknown
Chr6:40813125..40813147 19/23 unknown
Chr6:44807050..44807072 19/23 unknown
Chr6:50766672..50766694 19/23 unknown
Chr6:50766756..50766778 19/23 unknown
Chr6:50766917..50766939 19/23 unknown
Chr6:27443684..27443706 19/23 unknown
Chr6:31330084..31330106 19/23 unknown
Chr6:40812829..40812851 19/23 unknown
Chr6:40813024..40813046 19/23 unknown
Chr6:40813075..40813097 19/23 unknown
Chr6:7277870..7277892 19/23 unknown
Chr6:7277922..7277944 19/23 unknown
Chr6:7277974..7277996 19/23 unknown
Chr6:7278025..7278047 19/23 unknown
Chr6:7278077..7278099 19/23 unknown
Chr6:7278110..7278132 19/23 unknown
Chr6:7278222..7278244 19/23 unknown
Chr6:7278269..7278291 19/23 unknown
Chr6:85240038..85240060 19/23 unknown
Chr6:85240170..85240192 19/23 unknown
Chr6:7277607..7277629 19/23 unknown
Chr6:7277656..7277678 19/23 unknown
Chr6:7277705..7277727 19/23 unknown
Chr6:7277755..7277777 19/23 unknown
Chr6:7277788..7277810 19/23 unknown
Chr7:104521465..104521487 19/23 unknown
Chr7:104521654..104521676 19/23 unknown
Chr7:104521928..104521950 19/23 unknown
Chr7:104521978..104522000 19/23 unknown
Chr7:104522029..104522051 19/23 unknown
Chr7:104522062..104522084 19/23 unknown
Chr6:85240256..85240278 19/23 unknown
Chr6:89960603..89960625 19/23 unknown
Chr6:89960743..89960765 19/23 unknown
Chr6:90935636..90935658 19/23 unknown
Chr6:90935669..90935691 19/23 unknown
Chr6:90935733..90935755 19/23 unknown
Chr7:108112465..108112487 19/23 unknown
Chr7:108112513..108112535 19/23 unknown
Chr7:108112579..108112601 19/23 unknown
Chr7:114974279..114974301 19/23 unknown
Chr7:114974363..114974385 19/23 unknown
Chr7:114974448..114974470 19/23 unknown
Chr7:114974592..114974614 19/23 unknown
Chr7:104522143..104522165 19/23 unknown
Chr7:104522176..104522198 19/23 unknown
Chr7:104522262..104522284 19/23 unknown
Chr7:104522344..104522366 19/23 unknown
Chr7:104522394..104522416 19/23 unknown
Chr7:104522445..104522467 19/23 unknown
Chr7:106332556..106332578 19/23 unknown
Chr7:106332589..106332611 19/23 unknown
Chr7:106332667..106332689 19/23 unknown
Chr7:119284229..119284251 19/23 unknown
Chr7:119284278..119284300 19/23 unknown
Chr7:119284327..119284349 19/23 unknown
Chr7:126124803..126124825 19/23 unknown
Chr7:126979172..126979194 19/23 unknown
Chr7:126979205..126979227 19/23 unknown
Chr7:116949727..116949749 19/23 unknown
Chr7:116949812..116949834 19/23 unknown
Chr7:116949959..116949981 19/23 unknown
Chr7:116949993..116950015 19/23 unknown
Chr7:118683573..118683595 19/23 unknown
Chr7:118683833..118683855 19/23 unknown
Chr7:118907884..118907906 19/23 unknown
Chr7:118907967..118907989 19/23 unknown
Chr7:119284130..119284152 19/23 unknown
Chr7:35646592..35646614 19/23 unknown
Chr7:35646626..35646648 19/23 unknown
Chr7:35646694..35646716 19/23 unknown
Chr7:35646728..35646750 19/23 unknown
Chr7:35647349..35647371 19/23 unknown
Chr7:35647382..35647404 19/23 unknown
Chr7:35647465..35647487 19/23 unknown
Chr7:35647582..35647604 19/23 unknown
Chr7:35647616..35647638 19/23 unknown
Chr7:35647684..35647706 19/23 unknown
Chr7:26499119..26499141 19/23 unknown
Chr7:35646358..35646380 19/23 unknown
Chr7:35646391..35646413 19/23 unknown
Chr7:35646475..35646497 19/23 unknown
Chr7:43898329..43898351 19/23 unknown
Chr7:43898377..43898399 19/23 unknown
Chr7:43898446..43898468 19/23 unknown
Chr7:43898544..43898566 19/23 unknown
Chr7:44693310..44693332 19/23 unknown
Chr7:44693474..44693496 19/23 unknown
Chr7:51384297..51384319 19/23 unknown
Chr7:35647718..35647740 19/23 unknown
Chr7:39845254..39845276 19/23 unknown
Chr7:39845403..39845425 19/23 unknown
Chr7:39845454..39845476 19/23 unknown
Chr7:39845505..39845527 19/23 unknown
Chr7:39845590..39845612 19/23 unknown
Chr7:40453382..40453404 19/23 unknown
Chr7:40453452..40453474 19/23 unknown
Chr7:43898210..43898232 19/23 unknown
Chr7:51384556..51384578 19/23 unknown
Chr7:51385683..51385705 19/23 unknown
Chr7:51538533..51538555 19/23 unknown
Chr7:54292311..54292333 19/23 unknown
Chr7:54292427..54292449 19/23 unknown
Chr7:54292510..54292532 19/23 unknown
Chr7:88549488..88549510 19/23 unknown
Chr7:88549585..88549607 19/23 unknown
Chr7:88549633..88549655 19/23 unknown
Chr7:88549777..88549799 19/23 unknown
Chr7:88549862..88549884 19/23 unknown
Chr7:88549912..88549934 19/23 unknown
Chr7:88550112..88550134 19/23 unknown
Chr7:88550162..88550184 19/23 unknown
Chr7:9958243..9958265 19/23 unknown
Chr7:9958598..9958620 19/23 unknown
Chr7:9959041..9959063 19/23 unknown
Chr8:107236670..107236692 19/23 unknown
Chr8:121138913..121138935 19/23 unknown
Chr8:121138996..121139018 19/23 unknown
Chr8:121139061..121139083 19/23 unknown
Chr8:121139146..121139168 19/23 unknown
Chr8:121139193..121139215 19/23 unknown
Chr8:121139288..121139310 19/23 unknown
Chr8:121139382..121139404 19/23 unknown
Chr8:133946798..133946820 19/23 unknown
Chr8:133947202..133947224 19/23 unknown
Chr8:133947235..133947257 19/23 unknown
Chr8:138463441..138463463 19/23 unknown
Chr8:138463629..138463651 19/23 unknown
Chr8:138463698..138463720 19/23 unknown
Chr8:138463802..138463824 19/23 unknown
Chr8:138463871..138463893 19/23 unknown
Chr8:138463921..138463943 19/23 unknown
Chr8:138463974..138463996 19/23 unknown
Chr8:138464026..138464048 19/23 unknown
Chr8:138464113..138464135 19/23 unknown
Chr8:144582440..144582462 19/23 unknown
Chr8:22232157..22232179 19/23 unknown
Chr8:26246089..26246111 19/23 unknown
Chr8:28177151..28177173 19/23 unknown
Chr8:28177285..28177307 19/23 unknown
Chr8:28746063..28746085 19/23 unknown
Chr8:30757553..30757575 19/23 unknown
Chr8:30757639..30757661 19/23 unknown
Chr8:30757755..30757777 19/23 unknown
Chr8:30793257..30793279 19/23 unknown
Chr8:30793613..30793635 19/23 unknown
Chr8:30857539..30857561 19/23 unknown
Chr8:30857624..30857646 19/23 unknown
Chr8:30857741..30857763 19/23 unknown
Chr8:32817623..32817645 19/23 unknown
Chr8:32817892..32817914 19/23 unknown
Chr8:32817984..32818006 19/23 unknown
Chr8:40916151..40916173 19/23 unknown
Chr8:40916219..40916241 19/23 unknown
Chr8:43623078..43623100 19/23 unknown
Chr8:43623128..43623150 19/23 unknown
Chr8:43623226..43623248 19/23 unknown
Chr8:4945129..4945151 19/23 unknown
Chr8:4945209..4945231 19/23 unknown
Chr8:71071086..71071108 19/23 unknown
Chr8:71071153..71071175 19/23 unknown
Chr8:71527184..71527206 19/23 unknown
Chr8:72044579..72044601 19/23 unknown
Chr8:72044612..72044634 19/23 unknown
Chr8:72044677..72044699 19/23 unknown
Chr8:80495225..80495247 19/23 unknown
Chr8:80495309..80495331 19/23 unknown
Chr8:80495343..80495365 19/23 unknown
Chr8:85316077..85316099 19/23 unknown
Chr8:85316161..85316183 19/23 unknown
Chr8:94451253..94451275 19/23 unknown
Chr8:94451317..94451339 19/23 unknown
Chr8:94451383..94451405 19/23 unknown
Chr8:71070894..71070916 19/23 unknown
Chr8:99567370..99567392 19/23 unknown
Chr8:99567535..99567557 19/23 unknown
Chr9:2292106..2292128 19/23 unknown
Chr9:2292169..2292191 19/23 unknown
Chr9:2292202..2292224 19/23 unknown
Chr9:2292265..2292287 19/23 unknown
Chr9:2292393..2292415 19/23 unknown
Chr9:2292584..2292606 19/23 unknown
Chr9:24103731..24103753 19/23 unknown
Chr9:25799907..25799929 19/23 unknown
Chr9:25799984..25800006 19/23 unknown
Chr8:99567171..99567193 19/23 unknown
Chr8:99567252..99567274 19/23 unknown
Chr9:2646189..2646211 19/23 unknown
Chr9:2646255..2646277 19/23 unknown
Chr9:34440445..34440467 19/23 unknown
Chr9:34440640..34440662 19/23 unknown
Chr9:34440708..34440730 19/23 unknown
Chr9:34440995..34441017 19/23 unknown
Chr9:53512770..53512792 19/23 unknown
Chr9:53512870..53512892 19/23 unknown
Chr9:53512936..53512958 19/23 unknown
Chr9:58656687..58656709 19/23 unknown
Chr9:6386678..6386700 19/23 unknown
Chr9:6386744..6386766 19/23 unknown
Chr9:6386812..6386834 19/23 unknown
Chr9:2646075..2646097 19/23 unknown
Chr9:2646109..2646131 19/23 unknown
Chr9:6387029..6387051 19/23 unknown
Chr9:6387145..6387167 19/23 unknown
Chr9:64904868..64904890 19/23 unknown
Chr9:64904916..64904938 19/23 unknown
Chr9:64904950..64904972 19/23 unknown
Chr9:64904983..64905005 19/23 unknown
Chr9:64905095..64905117 19/23 unknown
Chr9:64905223..64905245 19/23 unknown
Chr9:64905255..64905277 19/23 unknown
Chr9:64905289..64905311 19/23 unknown
Chr9:64905323..64905345 19/23 unknown
Chr9:64905356..64905378 19/23 unknown
Chr9:6386880..6386902 19/23 unknown
Chr9:6386962..6386984 19/23 unknown
Chr9:73033195..73033217 19/23 unknown
Chr9:73033229..73033251 19/23 unknown
Chr9:73033278..73033300 19/23 unknown
Chr9:73033311..73033333 19/23 unknown
Chr9:73033373..73033395 19/23 unknown
Chr9:73033752..73033774 19/23 unknown
Chr9:73033850..73033872 19/23 unknown
Chr9:73033899..73033921 19/23 unknown
Chr9:73033950..73033972 19/23 unknown
Chr9:73033538..73033560 19/23 unknown
Chr9:73033572..73033594 19/23 unknown
Chr9:73033637..73033659 19/23 unknown
Publications
First: Developmental regulation of Wnt signaling by Nagk and the UDP-GlcNAc salvage pathway., Mech Dev 2019                                
Most recent:
View All Papers