Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22064113

Morpholino Name: uap1 MO1
Synonyms:
Target mRNA: uap1

Morpholino Type: uncategorized morpholino
Sequence: 5' TGACGAACAACTGCCACATCCATAC 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 25/25 24/25
genome
MO
5' GTATGGATGTGGCAGTTGTTCGTCA 3'
   |||||||||||||||||||||||||
3' CATACCTACACCGTCAACAAGCAGT 5'
5' GTATGGATGTGGCTGTTGTTCGTCA 3'
   ||||||||||||| |||||||||||
3' CATACCTACACCGTCAACAAGCAGT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:104216359..104216383 25/25 Antisense target uap1.L
Chr4S:87065982..87066006 24/25 Antisense target uap1.S
Publications
First: Developmental regulation of Wnt signaling by Nagk and the UDP-GlcNAc salvage pathway., Mech Dev 2019                                
Most recent:
View All Papers